NRFA

AcronymDefinition
NRFANational River Flow Archive
NRFANational Rural Fire Authority (New Zealand)
NRFANational Road Fund Agency (Zambia)
NRFANaval Reserve Force Active
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Finally, the nirK, nrfA, and nrfH encoding nitrite reductase enzymes are conserved in C.
Diversity and abundance of nitrate reductase genes (narG and napA), nitrite reductase genes (nirS and nrfA), and their transcripts in estuarine sediments.
Target organism/gene Primer Sequence (5'-3') Bacteria EUB338f ACTCCTACGGGAGGCAGC 926Rr CCCGTCAATTCMTTTGAGTTT Nitrosomonadaceae EUB338f ACTCCTACGGGAGGCAGC Nso1225r CGCCATTGTATTACGTGTGA Nitrosospira Nsv443f CGGAACGAAACGGTCACG 926Rr CCCGTCAATTCMTTTGAGTTT Nitrospira EUB338f ACTCCTACGGGAGGCAGC Ntspa0685r GGGAATTCCGCGCTCCT Nitrobacter EUB338f ACTCCTACGGGAGGCAGC NIT3r CCTGTGCTCCATGCTCCG amoA amoAf GGGGTTTCTACTGGTGGT amoAr CCCCTCKGSAAAGCCTTCTTC napA napA V66 TAYTTYYTNHSNAARATHATGTAYGG napA V67 NGGRTGCATYTCNGCCATRTT nrfA nrfAf GCNTGYTGGWSNTGYAA nrfAr TWNGGCATRTGRCARTC Streptococcus EUB338f ACTCCTACGGGAGGCAGC STRr GTGCAGAAGGGGAGAGTGG Enterococcus spp.
We are excited that he has chosen to join the NRFA team," said Robert L.
THE NATIONAL FROZEN & REFRIGERATED FOODS ASSOCIATION (NRFA) OF HARRISBURG,PA.and participating company brands are sponsoring Cool Food for kids, an educational out-reach program that's designed to educate children and families about important, timely health topics.
This year, NRFA is offering an exclusive retailer preview of Taste of Excellence during the first hour, allowing merchants to better connect with their customers.
For more information, call Alan at the NRFA on 07802 661707 or email Alan.Geddes@northridingfa.com.
Emphasizing the "locked-in" quality of frozen foods has been a centerpiece of NRFA's Real Food.
The National Frozen & Refrigerated Foods Association (NRFA) is putting muscle behind its work, in anticipation of National Frozen Foods Month in March.