OMPB

AcronymDefinition
OMPBOuter Membrane Protein B (gene)
References in periodicals archive ?
MF496152-MF496168 (rrs), MF496169MF496185 (gltA), MF496186-MF496199 (ompB), and MK102707-MK102720 (ompA).
Subsequently, the Rickettsia species positive DNA sample preparation from the R parkeri positive A maculatum adult tick was analyzed by multilocus sequence typing using ompA, ompB, and sca4 genes.
Among the major outer membrane surface proteins are OmpA and OmpB which are present in the Rickettsial Spotted Fever Group and the Transition Group, while the Typhus Group Rickettsia only have OmpB and his cellular receptor still unknown.
KF179352 and KY402193, respectively) from another tick in this group and sequences revealing complete identity to each other and to the homologous segments of the gltA (760 bp), ompB (760 bp), and ompA (490 bp) genes of R.
Smith then centralized the Board, the Theatres Inspection Branch and the OMPB under a newly established Amusement Branch.
The final supermatrix consisted of 2,308 bp (731 bp for gtlA, 429 bp for ompA, 744 bp for ompB, and 404 bp for htrA genes), with 670 variable sites, 494 singletons, and 176 parsimony informative sites.
As expected, conserved genes (17kDa and gltA) showed fewer substitutions than variable genes (ompA, ompB, and sca4).
obtained from Dermacentor reticulatus ticks from a migrating jackal, Denmark Primer name Primer sequence, 5' [right arrow] 3' 120-2,788 AAACAATAATCAAGGTACTGT 120-3,599 TACTTCCGGTTACAGCAAAGT Rr 190.70p ATGGCGAATATTTCTCCAAAA Rr190-701n GTTCCGTTAATGGCAGCATCT RpCS877p GGGGACCTGCTCACGGCGG RpCS1258n ATTGCAAAAAGTACAGTGAACA Primer name Target gene Length, bp Reference 120-2,788 ompB 765 (5) 120-3,599 Rr 190.70p ompA 631 (4) Rr190-701n RpCS877p gltA 380 (4) RpCS1258n
Screening of reads for sequences matching 5 rickettsial genes (rrs, ompA, ompB, gltA, and sca4) found 1 read mapping to the ompB gene (online Technical Appendix, https://wwwnc.cdc.gov/EID/ article/23/11/17-0474-Techapp1.pdf).
infection do not react against SFGR and TGR ELISA antigens (lipopolysaccharides OmpA and OmpB), because Orientia spp.
Although differences based on 2 gene segments support its designation as a novel species, isolation efforts and characterization of all 5 genes (rrs, gltA, ompA, ompB, and geneD) are warranted, according to the guidelines for classification of a new Rickettsia species (15).