PAS2

AcronymDefinition
PAS2Personal Application System /2
References in periodicals archive ?
Gene Primer sequence (5' to 3') Tm ([degrees]C) [beta]-Actin CTCTTCCAGCCATCCATGATCG 57.63 CCACTGAGGACAATATTGCCAT 55.16 LACS7 CAGGAGTTGAGGTTGTGACATATTC 56.05 AGAGCAGCCATATCATCCATTAGTT 56.28 LACS1 CAGGTTAGGTGGTCGGATTAGACT 57.86 TGATGGCTCCTCAAGTGGATTGT 58.43 ACC1 GAGAATTGCTGAAGAGTCGCTGAT 57.73 TGTTGGCTCCACCTTGCTTAGA 58.56 FAD7 ACTTCAACTCTGTGCTGGTCTCT 58.07 CCTCCTCGTAGATAACTCCATTCCT 57.29 LACS9 CGACTTACCACTTCCAGCCGATA 58.66 ACTTCCAACAGCAGCAATCACATT 58.22 ACX5 TGATGAGGGTTTCACAGGTTACAAG 57.32 AAGCATAAGCAGAAGCCAGCAA 57.86 PKT3 GCAGGATGGCGGCATTCTATG 58.74 AGAGGCAGTAGCAGCAGCAG 59.29 PAS2 CGTCTTCTTCGGATGGCTTCA 57.33 CAGTGTTGCTGAGATCGGAGAT 56.92 Table 2: Dynamic changes of fatty acid content in walnut kernel fat (%).
una de las demandas de la asociacion de academicos es precisamente transparentar esos criterios, que no queden sujetos a las personas que aplican la normativa" (PAS2).
(b) The papillae sensilla (PAS2) are present in the number of 11-12 pairs.
(d) One pair of pit sensilla is placed centrally together with two PAS2 on the round convex surface, while the remaining papillae sensilla (PAS2) in the number ranging from 8 to 11 pairs are distributed around them.
(e) The papillae sensilla PAS2 are more numerous and visible on the triangular labial tip.
In the Corixoidea, the triangular labial tip has several PAS2 and PES sensilla, unevenly spread.
The papillae sensilla (PAS1) are situated on the smooth tip in the Belostomatidae, Nepidae, and Nerthrinae (Gelastocoridae), and sensilla (PAS2) are situated at the folded tip in the remaining families.
Assuming the conservative approach to these observations I consider that the papillae sensilla (PAS1 and PAS2) are homologous in all nepomorphans.
In nepomorphans, the main group of the sensilla at the tip of the labium is that of the uniporous papilla sensilla (PAS1, PAS2) (Table 1(C)).