PDGFRB


Also found in: Medical.
AcronymDefinition
PDGFRBPlatelet-Derived Growth Factor Receptor, Beta
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
O'Driscoll, then found that multiple disease-associated mutations in PDGFRB caused a specific abnormality in its encoded protein.
The genes APP, SGSM1, ROR1, PDGFRB, GRIN3A, SEZ6L, NCOR1, FSHR, SLC22A2, TBC1D32, OCA2, and ASAH1, which also encompassed nsSNPs, were classified into Alzheimer's disease after reference to the GAD.
IMTs lacking ALK genetic rearrangements/fusions have been shown to have genomic rearrangements/fusions involving other receptor tyrosine kinases including NTRK3, PDGFRB, RET, and ROS1.
Mutation of the PDGFRB gene as a cause of idiopathic basal ganglia calcification.
Recent in vitro studies on Imatinib suggest that this molecule may trigger a response on cells expressing PDGFRB with mutations found in IM patients [10, 11].
Gene Forward primers (5'-3') Reverse primers (5'-3') [alpha]-Sma GACACCAGGGAGTGATGGTT GTTAGCAAGGTCGGATGCTC Colla1 GATGGCTGCACGAGTCACAC ATTGGGATGGAGGGAGTTTA Mmp-2 CTTGCTGGTGGCCACATTC CTCATTCCCTGCGAAGAACAC Mmp-9 CGCTCATGTACCCCATGTATCA TCAGGTTTAGAGCCACGACCAT Mmp-13 TCGCATTGTGAGAGTCATGCCAACA TGTGGTTCCAGCCACGCATAGTCA Timp-1 GACCACCTTATACCAGCGTT GTCACTCTCCAGTTTGCAAG Timp-2 GGATGGACTGGGTCACAGAG GCGCAAGAACCATCACTTCT Ccnb-1 CCCTACCAAAACCTGTGGAC CATCGGAGAAAGCCTGACAC Ccnb-2 TGGAGAGTGAAATACTGGAAGTCA TGAGAAGCACACGATGGAAG Pdgfrb GCACCGAAACAAACACACCTT ATGTAACCACCGTCGCTCTC Tgfbr1 ACCTTCTGATCCATCCGTT CGCAAAGCTGTCAGCCTAG
Compared to PET cocultures, significantly lower expression was observed for secreted protein that is acidic and rich in cysteine (SPARC, p = 0.003), collagen IV [alpha]1 (COL4A1, p = 0.003), and PDGFRB (p = 0.004).
The absence of FIP1L1-PDGFRA and PDGFRB gene fusion and unremarkable bone marrow biopsy ruled out most clonal forms of HSE.
Third, a number of gene targets identified by experts during the 2011 NTP workshop as relevant to the biological processes described in this article are not included in ToxCast[TM], including glucose transporter 2 (GLUT2), insulin receptor substrates 1 and 2 (IRS1, IRS2), the ZFP423 gene and Wnt genes involved in adipogenesis, leptin receptor (LEPR), fatty acid binding protein 4 (FABP4, found in adipocytes), and genes expressed in stem cells that populate white adipose tissue lineage and could be early indicators of commitment to adipocyte lineage (CD24, CD29, CD34, PDGFRb, NG2, Sca1).
The remaining 2 discrepancies were found in noncoding regions of the genes apolipoprotein A-V (APOA5) [4] and platelet-derived growth factor receptor beta (PDGFRB), and had MPG quality scores of 4 and 10, respectively (10).
Evidence has shown sustained clinical response, molecular remission, and low toxicity profile with imatinib treatment in patients harboring PDGFRB rearrangement [1] but there is little information on imatinib efficacy in patients with ET V6-ACSL6 gene fusion.
(2) By examining the genetics of families and individuals with IBGC, researchers have identified 2 main genes implicated in its development--sodium dependent phosphate transporter 2 (SLC20A2) on chromosome 8 and platelet derived growth factor receptor beta (PDGFRB) on chromosome 5.