PDHC

AcronymDefinition
PDHCPyruvate Dehydrogenase Complex (biochemistry)
PDHCPregnancy Decision Health Centers (Columbus, OH)
PDHCPictou District Honour Choir (Nova Scotia, Canada)
PDHCPlatform Dependent Hardware Controller (Hewlett Packard computer hardware component)
PDHCPatient Directed Health Care
References in periodicals archive ?
To study the sensitivity of the assay, several classical inhibitors of the mitochondrial energy-generating system were added to control fibroblasts: rotenone (for complex I), antimycin A (complex III), azide (complex IV), oligomycin (complex V), atractyloside [adenine nucleotide transporter (ANT)], [alpha]-hydroxycyanocinnamate (pyruvate carrier), and arsenite (PDHc and [alpha]-ketoglutarate dehydrogenase).
In a group of patients with decreased ATP production in fresh muscle, a subgroup could be identified with clearly reduced oxygen consumption rate, despite normal OXPHOS enzymes and PDHc activities.
[2] Nonstandard abbreviations: MEGS, mitochondrial energy-generating system; PDHc, pyruvate dehydrogenase complex; TCA, tricarboxylic acid; OXPHOS, oxidative phosphorylation; DMEM, Dulbecco's modified Eagle's medium; FBS, fetal bovine serum; SETH, sucrose, EDTA, Tris-HCl, and heparin; ROCR, relative oxygen consumption rate; CS, citrate synthase; RFU, relative fluorescence units; ANT, adenine nucleotide transporter; CCCP, carbonyl cyanide 3-chlorophenyl hydrazone; mtDNA, mitochondrial DNA; ROS, reactive oxygen species.
The results from muscle biopsies from 29 patients with deficiencies in PDHc and OXPHOS enzymes illustrate the rationale of our approach.
We tested the validity of the methods by examining muscles of 29 patients with deficiencies in either one of the OXPHOS complexes, PDHc, or ANT.
1) to prevent inhibition of PDHc by accumulation of its product.
PDHc is a multienzyme complex localized in the inner mitochondrial membrane.
PDHc is regulated mainly by a phosphorylation-dephosphorylation cycle catalyzed by PDH kinase or phosphatase, respectively (4).
The central role of PDHc in mitochondrial energy metabolism and the severe consequences of PDHc deficiency (7) underline the necessity of having a reliable method for PDHc analysis in the diagnostic work-up of mitochondrial disorders.
Multilocus sequence typing results of two serogroup X Neisseria meningitidis clonal groupings Allele numbers ST AbcZ Adk aroE FumC gdh pdhC Pgm 24 2 5 2 7 15 20 5 750 2 5 2 9 15 20 5 181 10 3 15 7 5 41 31 182 10 3 15 26 5 41 31 751 10 3 15 7 8 41 6 ST Country (no.
Country abcZ adk aroE fumC gdh pdhC pgm 1988 Chad 1 1 2 1 3 2 3 1991 Djibouti 1 1 2 1 3 2 3 1992 Algeria 1 1 2 1 3 2 3 Algeria 1 3 1 1 1 1 3 Burundi 1 1 2 1 3 2 3 CAR 1 1 2 1 3 2 3 1993 Cameroon 1 1 2 1 3 2 3 Guinea- 1 1 2 1 3 2 3 Bissau 1994 Burundi 1 1 2 1 3 2 3 Cameroon 1 1 2 1 3 2 3 Chad 1 1 2 1 3 2 3 Zaire 1 1 2 1 3 2 3 1995 Algeria 1 1 2 1 3 2 19 Cameroon 1 1 2 1 3 2 3 Burk.
Both strands of fragments of abcZ, adk, aroE, gdh, pdhC, pgm, and fumC were sequenced as described (http:// www.mlst.net), except that primers 01101 (5'TCCGGCTTGCCGTTTGTCAG) and 01102 (5'TTGTAGGCGGTTTTGGCGAC) were used for fumC.