PDP1

AcronymDefinition
PDP1Par Domain Protein 1
References in periodicals archive ?
For Drosophila dsRNA RNAi, the corresponding RNAs were synthesized in vitro from DNA oligonucleotides with an attached T7 RNA polymerase promoter sequence (IDT DNA Technologies) targeting the aacttccctcctcagttgccgg cDNA region common to all Pdp1 isoforms (AF172402, AF172403, AF172404, AF172405, AF172406, and AF209903), the agttacgcgttgttgctgcgacc cDNA region unique to Pdp1[gamma] (AF172404), and the aacgtaccagaggatttaccagg region unique to Pdp1[epsilon] (AF172406).
The previous results were obtained with the dsRNA targeted at a sequence common to all known Pdp1 isoforms.
In this work, we confirmed and expanded our serendipitous observation that a systemic PDP1 knockdown in adult flies, induced by injections of Pdp1 dsRNAs, leads to a significant lipid decrease, and we found that similar phenotype can be induced by HLF RNAi in mouse adipocytes in vitro.
Both mammalian HLF and Drosophila PDP1 are known components, that is, output regulators, of circadian cycles and as such have been linked to metabolic regulation [15].
Our experiments with adipocytes show that in addition to systemic PDP1/HLF alterations (e.g., systemic PDP1 knockdown in adult flies), also direct cellular HLF alterations (e.g., knockdown in 3T3-L1 cells) can reduce lipid content.
Abbreviations DBP: Albumin D site-binding protein dsRNA: Double-stranded RNA HLF: Hepatic leukemia factor PAR: Proline- and acidic amino acid rich PDP1: PAR-domain protein 1 RNAi: RNA interference SGADs: Second generation antipsychotic drugs TEF: Thyrotroph embryonic factor.
Storti for PDP1 antibodies, and the late Erminio Costa, Director of the Psychiatric Institute, for support.
Storti, "PDP1, a novel Drosophila PAR domain bZIP transcription factor expressed in developing mesoderm, endoderm and ectoderm, is a transcriptional regulator of somatic muscle genes," Development, vol.
Reddy et al., "vrille, Pdp1, and dClock form a second feedback loop in the Drosophila circadian clock," Cell, vol.
A digoxigenin (DIG)-labeled antisense RNA probe (probe #1) was generated from DdeI-digested pDP1.NA using T7 polymerase and the DIG-RNA labeling kit (Boehringer-Mannheim) according to manufacturer's instructions.