PECAM-1

AcronymDefinition
PECAM-1Platelet Endothelial Cell Adhesion Molecule 1
References in periodicals archive ?
Newman, "PECAM-1: regulator of endothelial junctional integrity," Cell and Tissue Research, vol.
Gene Primer sequences GAPDH GTGGACCTGACCTGCCGTCT (F) GGAGGAGTGGGTGTCGCTGT (R) vWF TAGAATCCTTACCAGTGACG (F) ACTCACACTCATACCCGTTC (R) PECAM-1 GCTGACCCTTCTGCTCTGTT (F) TGAGAGGTGGTGCTGACATC (R) hCOL2A1 GCTCCCAGAACATCACCTACC (F) CAGTCTTGCCCCACTTACCG (R) hACAN GCCTATCAGGACAAGGTCTCAC (F) ATGGCTCTGTAATGGAACACGA (R)
Yang, "Association of PECAM-1 gene polymorphisms with Kawasaki disease in Chinese children," Disease Markers, vol.
Preterm delivery False preterm delivery Mean (pg/ml) [+ or -]SEM Mean (pg/ml) [+ or -]SEM BDNF 49.41 4.10 31.87 2.33 BLC 45.28 5.69 22.75 2.42 Eotaxin-1 1.68 0.16 1.03 0.08 Eotaxin-2 9.37 0.08 9.21 1.36 E-Selectin 393.43 29.80 372.55 32.41 ICAM-1 502.77 42.30 459.14 33.20 IGFBP-1 177.97 41.57 144.57 33.35 IGFBP-2 429.72 65.63 424.00 34.55 L-Selectin 2369.2 318.13 2379.9 265.01 MIP-1d 25.01 6.63 27.79 6.10 MIP-3b 31.16 5.19 24.22 4.75 PECAM-1 27.94 12.03 31.78 17.66 VCAM-1 44.87 20.44 36.09 10.46 p BDNF 0.004 BLC 0.005 Eotaxin-1 0.001 Eotaxin-2 0.607 E-Selectin 0.953 ICAM-1 0.699 IGFBP-1 0.001 IGFBP-2 0.695 L-Selectin 0.888 MIP-1d 0.092 MIP-3b 0.93 PECAM-1 0.248 VCAM-1 0.158 Table 3: Predictive values of selected markers marked with discriminant analysis by standard method.
In the EE, PECAM-1 staining is typically confined to the border
For example, the following genes exhibited statistically significant (P<05) modulation early in Zone I and late in Zone II: CDH5, PECAM-1, SERPINF1, TGFBR1, Endothelial cell growth factor-1 (Ecgfl), Endothelial PAS domain protein-1 (Epasl), Epiregulin (Ereg), Interleukin 12a (1112a), Integrin aV (Itgav), Nudix-type motif 6n (Nudt6), and Tumor necrosis factor ligand superfamily member-12 (Tnfsfl2).
At day 21, fluorescent staining clearly showed the presence of the BMEC marker PECAM-1 and the astrocyte marker GFAP (Figure 1).
Furthermore, endotoxin upregulates expression of a number of chemokines that act as chemoattractans and leukocytes activators (monocytes chemoattractant protein1 and IL-8) and adhesion molecules (selectins, ICAM-1, VCAM-1, and platelet and endothelial cell adhesion molecule-1 (PECAM-1)).
PECAM-1, a surface marker of vascular endothelial cell, also was involved in the regulation of angiogenesis and was detected by immunohistochemical staining.
To quantify microvascular density after MCAO, images of the ischemic cortex and the contralateral cortex were acquired using a Leica fluorescence microscope, the PECAM-1 positive cells or CD34 were positive cells counted in each image and the mean of the total positive cell counting was considered as microvascular density [14,15].
Polyphenolic grape extract inhibits platelet activation through PECAM-1: an explanation for the French paradox.
Positive binding of primary antibodies against CD31 (PECAM-1) and von Willebrand Factor (vWF) is depicted in red.