PGR2


Also found in: Medical.
AcronymDefinition
PGR2Project Gotham Racing 2 (video game)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Screening was done on the basis of colony PCR using gene junction primers PGF2 junc (ATCCTTCGCAAGACCCTTCC), PGR2 junc (TGGAGTTGGAGTTGGACGAC), GTF2 junc (ATGACGAACTACCCCTTCGC) and GTR2 junc (TAATCATCGCAAGACCGGCA) (Table 1).
Chiu, "A new MIP test for S3 PGR2," in Global Perspective for Competitive Enterprise, Economy and Ecology, Advanced Concurrent Engineering, pp.
The first two on the original X-Box were a revelation, especially PGR2 with its revolutionary X-Box Live play.