PKLR

AcronymDefinition
PKLRPyruvate Kinase, Liver and RBC (Red Blood Cell)
PKLRRed Cell Pyruvate Kinase
References in periodicals archive ?
In this study, hepatic mRNA levels of the PKLR gene were lower (p<0.01) in steers than in bulls.
Negative correlations of MS and QG with hepatic mRNA levels of the G6PC (r = -0.51, p<0.05; r = -0.45, p< 0.05) and PKLR (r = -0.58, p<0.01; r = -0.64, p<0.01) genes were observed.
In this study, steers showed the higher hepatic mRNA levels of the PKLR gene than bulls indicating lower PEP conversion for ATP production following castration.
For example, the addition of TCDD to HFD altered the expression of key genes of lipid metabolism such as Ppara, Mlxipl/Chrebp, Cpt1a, Fasn and Dgat2 in a direction that is opposite to that exerted by HFD alone (decrease instead of increase) whereas TCDD exerts its effects in the same direction as HFD on Pparg and Cd36 (increase) or Srebf1/Srebplc, Acaca and Pklr (decrease).
The effect of TCDD on the expression of Cd36, Cpt1a, Acaca, Fasn and Pklr is in accordance with the literature (Angrish et al.
Target gene Forward primer Reverse primer (5'-3') (5'-3') Pyruvate kinase-coding GAACTTGCCAAATGCCGA CACGCCTTCATGGTTCTCG gene pklr (GenBank: NM_001099779.1) GLUT2-coding gene TCAGAAGACAAGATCACCG ATAGTTAATGGCAGCTTTCCG slc2a2 (GenBank: NM_031197.2) Glyceraldehyde AGCCTCGTCCCGTAGACA CACCAGTAGACTCCACGACA phosphate dehydrogenase- coding gene gapdh (GenBank: NM_008084.2)