PPARD

AcronymDefinition
PPARDPeroxisome Proliferator-Activated Receptor Delta
References in periodicals archive ?
5 h postmortem, representing the chicken collected after chilling process, might possess adequate quality to be investigated for certain genes, such as PDK4 and PPARD, but not be suitable for transcriptome analysis as abundance of some genes might be reduced due to partial RNA degradation.
5 h postmortem, but PDK4 and PPARD abundance of the 6 h samples significantly decreased.
1 IGF1 F: TCTCAACATCTCACATCTCT 136 R: AAGCAGCACTTAACTAATTGT NM_001199909 PDK4 F: TGCAATCACCAAAGGTCACCA 87 R: TGCAGTAGCTGAAGCTGTGTT NM_204728 PPARD F: TCTCCAAGCACATCTACAA 75 R: CGGTCAAGATACCTCTCG NM_00166326 PPIA F: GGCTCCCAGTTCTTCATC 143 R: ATCTGCTTGCTCGTCTTG NM_205103 TBP F: TGAATAGCACACGCACTA 178 R: GAGGCAACACATACTGAAC GenBank [T.