PRKCA


Also found in: Medical.
AcronymDefinition
PRKCAProtein Kinase C, Alpha
References in periodicals archive ?
(b) Segregation of HCC cell lines with respect to their epithelial versus mesenchymal characteristics is analyzed on "EMBL-EBI Expression Atlas" database through the transcript levels of PLXNC1, CDH1, PRKCA, and VIM in HCC cells.
A second gene of apparent relevance with which a DM site was associated was the protein kinase C, alpha gene (PRKCA) (Table 3).
Primer pair sequences (forward and reverse, 5' to 3') were as follows: [beta]-Actin: AGCCTCGCC TTTGCCGA and GCGCGGCGATATCATCATC; RPL13A: TACCAGAAAGTTTGCTTACGTGGG and TGCCTGTTTCCGTAACCTCAAG; PRKCA: GCTTCCAGTGCCAAGTTTGC and GCACCCGGACAAGAAAAAGTAA; LTF: ATGGTGGTTTCATATACGAGGCA and GCCACG GCATAATAGTGAGTT; c-FOS: AAAAGGAGAATCCGAAGGGAAA and GTCTGTCTCCGCTTGGAGTGTAT; pS2 (TFF1): AGGCCCAGACAGAGACGTGTAC and CGT CGAAACAGCAGCCCTTA.
In particular, miR-129 has 16 predicted target genes [platelet-derived growth factor receptor, alpha polypeptide (PDGFRA); platelet-derived growth factor receptor, beta polypeptide (PDGFRB); epidermal growth factor receptor (EGFR); phospholipase C, gamma 1 (PLCG1), SHC (Src homology 2 domain containing) transforming protein 4 (SHC4); protein kinase C, alpha (PRKCA); protein kinase C, beta (PRKCB); protein kinase C, delta (PRKCD) protein kinase C, epsilon (PRKCE); protein kinase C, iota (PRKCI); growth factor receptor-bound protein 2 (GRB2); son of sevenless homolog 1 (SOS1); SOS2; v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS); death-associated protein kinase 1 (DAPK1); DAPK2; DAPK3; and ribosomal protein S6 kinase, 90kDa, polypeptide 5 (RPS6KA5) (also known as MSK1)].
Ten are of known function [GJA1, ITGB3, collagen type I alpha 1 (COL1A1), IGFBP5, MMP2, myosin light polypeptide kinase (MYLK), GATA binding protein 6 (GATA6), chemokine (C-C motif) ligand 2 (CCL2), protein kinase C alpha (PRKCA), and nudeoporin (NUP88)], and one has unknown function.