PROP1

AcronymDefinition
PROP1Proposition One (grassroots nuclear disarmament organization)
References in periodicals archive ?
PROP1 mutation screening detected a homozygous deletion of the entire PROP1 in three patients.
PROP1 gene was amplified using PCR primers: Forward (5' ACCTACACACACATTCAGAGAC 3'), Reverse (5' TGGAGCCTATGCTTTCAGC 3'), Forward (5' AAAGACTGGAGCAGCACAGG3'), Reverse (5' GGTGGTGAGATGAGGCCTGT 3'), and Forward (5' GCCTTGTGGAAGAGCTTTACTCC 3'), Reverse (5' CACCATGCATCTGCTTCACCC 3').
PROP1 overexpression in corticotrophinomas: evidence for the role of PROP1 in the maintenance of cells committed to corticotrophic differentiation.
Molecular basis for pituitary dysfunction: Comparison of Prop1 and Pit1 mutant mice.
Table 4 contains the descriptive statistics of the variables used as proxies for ownership structure (PROP1, CON1, and LnVPROP1) and the market value of the organizations (QTOBIN and EV).
The specifications can be divided into two groups according to the independent variables of ownership concentration used: PROP1 (incentive effect) and PROP12 (entrenchment effect); or LnVPROP1 (incentive effect) and CON1 (entrenchment effect).
prop1 stands for that P intends proposition "R believes p being hold at time [t.sub.p]" being hold.
En la primera se analiza el desempeno de las companias chilenas empleando como variable dependiente Q de Tobin (QTOBIN (5)) y como variables explicativas, en una primera regresion, PROP1 (concentracion de la propiedad en manos del principal accionista), TAMANO (tamano de la firma), APALANC (riesgo financiero) y BETA (riesgo de mercado); en la segunda regresion cambia la variable explicativa PROP1 por PROP3 (concentracion de la propiedad en manos de los tres principales accionistas) y el resto de las variables (dependiente y explicativas) se mantienen.
Mutations of PROP1 are the most frequent genetic defect in non-syndromic combined pituitary hormone insufficiency and are characterized by growth hormone (GH), prolactin, TSH, and gonadotropin deficiency.
The most commonly recognized genetic defects associated with CPHD include mutations within PROP1, POU1F1, HESX1, LHX3, LHX4, OTX2, GLI2, and SOX3.
HESX1, POU1F1, PROP1, LHX4, LHX3, and OTX2 genes have been associated with combined pituitary hormone deficiencies to date.
Because of the combination of central hypothyroidism, GH deficiency, low PRL status, and normal pituitary imaging, genetic testing of PROP1 and POU1F1 was performed, but no mutations were found.