PSGR

AcronymDefinition
PSGRPassenger
References in periodicals archive ?
The qRT-PCR primers were as follows: PSA-forward primer GTCTGCGGCGGTGTTCTG, PSA-reverse primer TGCCGACCCAGCAAGATC; PCA3 forward primer TGGTGGGAAGGACCTGATGATACAG, PCA3 reverse primer TCTCCCAGGGATCTCTGTGCTTCC; PSMA forward primer GCCCACAGGAACAAGTCCTA, reverse primer CTCTGCAATTCCACGCCTAT; PSGR forward primer CATGGCCTTTGACCGTTATGT, reverse primer GCCAATCTGGGCTGTTACTGTAT; and MALAT1 forward primer CTTCCCTAGGGGATTTCAGG, MALAT1 reverse primer GCCCACAGGAACAAGTCCTA.
The PCA3 score, PSGR score, and MALTA-1 score were significantly higher in PCa patients than in patients with negative biopsies (P = 0.0001 and 0.0001, resp.; Figure 1).
Age, prostate volume, % fPSA, DRE results, PCA3 score, PSGR score, and MALAT-1 score were significant predictors for biopsy results in the univariate logistic regression analysis whereas PSA and PSMA were not (Table 2).
The diagnostic performance of PCa3, PSGR, and MALAT-1 is characterized in Table 3.
However, when we added the three novel biomarkers (PCA3, PSGR, and MALAT-1) to the base model to establish an improved model, we found that the predictive accuracy was improved to 84.4% and the AUC of the improved model was 0.846 (95% CI: 0.766, 0.927) (Table 4, Figure 2).
To the best of our knowledge, this is the first study investigating the diagnostic performance of PCA3, PSGR, MALAT-1, and PSMA in an Asian population.
We observed no expression of AR, carcinoembryonic antigen (CEA), cytokeratin 5 (CK5), CK19, EGFR, estrogen receptor-[beta] (ER-b), HK2, MGB1, MGB2, PSA, PSGR, PSMA, or tumor-associated calcium signal transducer 2 (Trop2) in any of the libraries from the controls.
The relative expression of CK19, PSA, PSMA, AR, HPN, HK2, PSGR, MGB1, and MGB2 in the mRNA libraries from CTC-enriched samples obtained from 23 samples from 9 patients with metastatic CaP are shown in Fig.
However, these CTCs were negative on RT-PCR for PSA, PSMA, HK2, and PSGR, suggesting that they might express different genes reflecting their different disease biologies.
PSGR, a novel prostate-specific gene with homology to a G protein-coupled receptor, is overexpressed in prostate cancer.
Discounts Passenger discounts, such DISCOUNTS--NO FARE IS as infant, children, or CHARGED FOR AN INF senior citizens, may PSGR UNDER 2 YRS NOT apply.