PTBP1

AcronymDefinition
PTBP1Polypyrimidine Tract Binding Protein 1 (gene)
References in periodicals archive ?
PTBP1 and PTBP2 could be visualized as siblings born to be musicians, but PTBP1 is a master of classical music, while PTBP2 masters contemporary music.
Neural stem cells and neurons have somewhat different collections of RNA thanks to the activity of PTBP1 and PTBP2.
Vuong et al., "PTBP1 and PTBP2 Serve Both Specific and Redundant Functions in Neuronal Pre-mRNA Splicing," Cell Reports, 2016; 17 (10): 2766 DOI: 10.1016/j.celrep.2016.11.034
Interestingly, in AD research, our data showed G3BP1 was regulated by ANAPC5, COPA, PTBP1, STIP1, and ZNF206.
In incipient AD, COPA and STIP1 positively regulated TFII (GTF2I); in moderate AD, ANAPC5 and COPA positively regulated TFII (GTF2I); in severe AD, only COPA positively regulated TFII (GTF2I), but STIP1 and PTBP1 negatively regulated TFII (GTF2I).
As Table 1 showed, NONO (p54nrb) can be regulated by many kinds of TFs, such as ZNF207, BUB3, PTBP1, POLR2E, STIP1, and ANAPC5.
ENO1 was regulated by ZNF207, BUB3, PTBP1, E2F4, POLR2E, and STIP1.
Since deregulated expressions of splicing factors such as PTBP1, SF2/ASF (SRSF1, SRSF5), and hnRNPs are the major cause that interfere with the homeostatic signaling proteins by inducing translational expression of diversified alternative splice variant, with antiapoptotic gain or apoptotic loss in advancement of tumorigenicity.
To extend GSK3beta kinase activity forward in term of regulation of splicing factors such as PTBP1, SF2/ASF and hnRNPs, which are the leading cause for the origination of alternative splice encoded proteins are of wide concern, such as caspase 9 variant origination involve in occurrence of alternative escape apoptotic pathways [23] found Akt kinase dependent [8].
In conclusion GSK3beta inhibition results in decrease in splicing factors such as PTBP1, SF2/ASF, and hnRNPA1, decrease in antiapoptotic regulators, and increase in Anxa7.
number Gene name Forward primer (5' to 3') 1 GAPDH 5'ACCACAGTCCATGCCATCAC 3' 2 SF2/ASF1 5'CACTGGTGTCGTGGAGTTTG 3' 3 hnRNPH3 5' TGAGGCTAGTGATGGGACAG 3' 4 PTBP1 5' ACGGACCGTTTATCATGAGC 3' 5 Survivin 5' TTGCTCCTGCACCCCAGAGC 3' 6 BCL-xL 5' TCTCCTTTGGCGGGGCACTG 3' 7 BCL2 5'CTCTCGTCGCTACCGTCGCG3' 8 MCL1 5' TGGAGGTGAACCCGACT TCCATG 3' 9 BMI1 5'GGAGACCAGCAAGTATTGTCCTATTTG3' 10 Anxa7 VB (WT) 5'TCTCCTGTTTCTTTGGATTATAG 3' 11 Anxa7 VA 5'CCCTAGTCAGCCTGCCACAGT3' S.
In neural stem cells, Pnky and PTBP1 appear to function together to suppress the production of neurons.