PWO


Also found in: Wikipedia.
Category filter:
AcronymDefinition
PWOPre-Workout
PWOPrince of Wales's Own (Regiment of Yorkshire)
PWOPerfect Working Order (classifieds)
PWOPreferred Walk-On (college sports)
PWOPublic Severe Weather Outlook (US NOAA)
PWOPublic Works Officer (US Navy)
PWOPhilatelic Webmasters Organization
PWOPost Work Out (after exercise)
PWOPayment With Order (advance payment)
PWOPweto, Zaire (airport code)
PWOPrinciple Warfare Officer (Royal Navy)
PWOPublic Welfare Offense
PWOProfessional Wastewater Operators
PWOPichu's World Oekaki (gaming)
PWOPokemon World Online
PWOPoor Wandering One (song; Pirates of Penzance)
PWOProcurement Work Order
PWOPractical World Outlook
PWOPfeizer Wind Orchestra (Kent, UK)
PWOProfessional Warfare Operations (gaming clan)
PWOPeter's World Order
PWOPlumb Wore Out
PWOPhysician Written Opinion
PWOPeople's Welfare Organization (Sri Lanka)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
"The main charter is for her to create awareness about sexual abuse," explains Robby de Luzuriaga, head of PWO. "And the reason for that is because the ratio of one girl that is abused for every four or five girls.
(1.) Whilst Plong people are commonly referred to as 'Pwo' in studies of the Karen, I prefer to use the term 'Plong', as the people refer to themselves and their language in this way.
For example, the two largest groups usually categorised as 'Karen'--who speak mutually unintelligible languages--tend to self-identify with the terms 'Sgaw' or 'Pwa Kan Yaw' and 'Pwo' or 'Ploan'.
She is interested in the experiences of Black men working in PWOs because of her experiences of being one of a few Black individuals working and studying at a PWO, in addition to her observations of her brother's early career experiences.
President PWO Mohammad Zubair said the Muslims of the subcontinent had resolved to achieve a separate homeland in order to lead their lives with dignity honor and freedom.
She informed that the PWO had formed a Himmat Network of various organizations working on special persons in Khyber Pakhtunkhwa, to which, responsibility of conducting the survey under auspices of PWD, had been given, which after four research the report filed.
Thus, the objectives of this study are to determine (1) whether the use of SRIs is associated with OSA severity in a population consisting of both PWO and PWE and (2) whether OSA severity, as a function of SRI status, differs in PWE compared to PWO.
For example, lead tungsten crystals (PWO) with high density and fast decay times are used in electromagnetic part of the Compact Muon Selenoid (CMS) to measure incident electron or photon beam energies which is used to search Higgs boson [1, 2].
The latter is an example of the Pwo genre, a type of mask that celebrates female ancestry, used during initiation ceremonies.
cDNA from adult mouse tissues were amplified with the Pwo SuperYield DNA Polymerase (Roche 04 340 850 001) using oligos representing the ends obtained through RACE experiments and the 5' oligo designed on the second upstream CAGE site reported in UCSC--Klhl14-AS CAGE II: CGCGTACTGCATGCGGGTCTCA, Klhl14-AS 5'RACE: GAGAGAGGAACAACAATCAAGGC, Klhl14-AS 3'RACE: GGGGATTAGAGTTTATTTTTGTCATCTC, and Klhl14-AS 3'RACE inner: ATTCATCCAGATCACAGCTAAG.
33 [+ or -] 1 Wo 15 [+ or -] 2 29 [+ or -] 2 PWo 11 [+ or -] 1 30 [+ or -] 1 Co n.a.