PNK

(redirected from Polynucleotide Kinase)
Also found in: Medical.
AcronymDefinition
PNKPolynucleotide Kinase
PNKPhosphorus, Nitrogen, Potassium (fertilizer)
PNKProzessnahe Komponente (German)
PNKPontianak, Indonesia - Supadio (Airport Code)
PNKPutri Naga Komodo (Indonesian: Komodo National Park; Indonesia)
PNKPersatuan Nelayan Kawasan (fishermen's association; Malaysia)
PNKParc National Kootenay (French: Kootenay National Park; Canada)
PNKPeritoneal Natural Killer (clinical nutrition)
References in periodicals archive ?
A 30-bp double-stranded oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3') was end-labeled with [[Gamma]-[sup.32]P]ATP using T4 polynucleotide kinase and purified with ProbeQuant G-50 Micro Columns.
A 38-bp double-stranded oligonucleotide with a Hae III cleavage site (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGGC CAAAAAA3') was end-labeled with [[Gamma]-[sup.32]P]ATP using T4 polynucleotide kinase, extracted with an equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) twice, precipitated with 0.05 volumes of 5 mol/L NaCl and 2.5 volumes of absolute ethanol, and sedimented at 14000 rpm for 10 minutes.
Primers were endlabeled in a volume of 5 [micro]L containing 1 [micro]L of 5X kinase buffer (Life Technologies), 2.5 [micro]L (3 ng/[micro]L) of primer, 1 [micro]L of [[gamma]-[sup.32]P]-ATP, 0.5 [micro]L of T4 polynucleotide kinase (Life Technologies); and were incubated at 37[degrees]C for 20 min, 55[degrees]C for 10 min; and then placed on ice.