PCNA

(redirected from Proliferating cell nuclear antigen)
Also found in: Dictionary, Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to Proliferating cell nuclear antigen: PCNA
AcronymDefinition
PCNAProliferating Cell Nuclear Antigen
PCNAPreventive Cardiovascular Nurses Association
PCNAPepsi Cola North America
PCNAProject Capital Needs Assessment (cost estimate)
PCNAPost Conflict Needs Assessment (United Nations)
PCNAPanasonic Corporation of North America
PCNAPudelpointer Club of North America
PCNAPorsche Cars of North America, Inc.
References in periodicals archive ?
List of primers used for quantitative real-time polymerase chain reaction Gene (ID) Primer sequence 5'-3' GAPDH F: AGGTCGGTGTGAACGGATTTG XM_017321385.1 R: TGTAGACCATGTAGTTGAGGTCA Caspase-3 F: AGCAGCTTTGTGTGTGTGATTCTAA XM_017312543.1 R: AGTTTCGGCTTTCCAGTCAGAC BAX F: CAGGATGCGTCCACCAAGAA XM_01 1250780.2 R: GCAAAGTAGAAGAGGGCAACCA PCNA F: TAAAGAAGAGGAGGCGGTAA NM_01 1045.2 R: TAAGTGTCCCATGTCAGCAA Cyclin B1 F: AGATGCAGTTGGCACCATGT NM_172301.3 R: TTCGACAACTTCCGTTAGCCT Annealing Fragment temperature Gene (ID) length (bp) ([degrees]C) GAPDH XM_017321385.1 123 60 Caspase-3 XM_017312543.1 137 60 BAX XM_01 1250780.2 197 60 PCNA NM_01 1045.2 175 60 Cyclin B1 NM_172301.3 148 60 GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BAX, Bcl-2-associated X protein; PCNA, proliferating cell nuclear antigen.
HULC: long non-coding RNA highly upregulated in liver cancer; pEX-HULC: pEX-2 plasmid carrying full-length HULC; PCNA: proliferating cell nuclear antigen.
Ford et al., "Proliferating cell nuclear antigen (PCNA) expression in chronic lymphocytic leukemia (CLL)," Leukemia and Lymphoma, vol.
Xiong, "Suppression of cell transformation by the cyclin-dependent kinase inhibitor p57KIP2 requires binding to proliferating cell nuclear antigen," Proceedings of the National Academy of Sciences of the United States of America, vol.
Molecular cloning of proliferating cell nuclear antigen and its differential expression analysis in the developing ovary and testis of penaeid shrimp Marsupenaeus japonicus.
The expression of COX-2, proliferating cell nuclear antigen (PCNA), Bcl-2, Bax and matrix metalloproteinase-2 (MMP-2) was detected by Western blot analysis.
PCNA, proliferating cell nuclear antigen, is the necessary component for DNA duplication of cell chromatosome.
Tumors were immunohistochemically analyzed for proliferating cell nuclear antigen, terminal deoxynucleotidyl transferase-mediated nick end labeling, and CD31.
It was reported yesterday that APIM Therapeutics, a pre-clinical biotech company focusing on the development of novel peptide therapeutics targeting Proliferating Cell Nuclear Antigen, a validated cancer target implicated in the regulation of cellular responses to various stress signals, has completed a financing round.
Several studies have emphasized the association of PCNA-LI (Proliferating Cell Nuclear Antigen Labeling Index) with tumor malignancy grade and to have prognostic significance in a number of malignancies.