POMC

(redirected from Proopiomelanocortin)
Also found in: Medical, Wikipedia.
AcronymDefinition
POMCProopiomelanocortin
POMCParents of Murdered Children
POMCPort of Melbourne Corporation (Melbourne, Australia)
POMCNational Organization of Parents Of Murdered Children, Inc. (since 1978; Cincinnati, Ohio)
POMCPeace and Order Maintaining Command (Thailand)
POMCParents of Missing Children (various locations)
POMCPagans Outlaw Motorcycle Club
POMCPick Off Mirror Cover
POMCPetty Officer Management Course (Royal Australian Navy)
References in periodicals archive ?
Increased prepubertal body weight enhances leptin sensitivity in proopiomelanocortin and neuropeptide Y neurons before puberty onset in female rats.
Corticotropin releasing hormone and proopiomelanocortin involvement in the cutaneous response to stress.
AtT20 cells were incubated with USP8 inhibitor for 4 and 24 h to determine its effects on proopiomelanocortin (POMC) mRNA levels.
bp) [beta]-actin L08165 F: TGCGTGACATCAAGGAGAAG 300 R: TGCCAGGGTACATTGTGGTA 18S AF173612 F: ATAACGAACGAGACTCT GGCA 136 R: CGGACAT C TAAGGGCAT CACA NPY M87294 F: GAGGCACTACATCAACCTCATCAC 101 R: TGTTTTCTGTGCTTTCCCTCAA CRH NM 001123031 F: CTCCCTGGACCTGACTTTCC 86 R: TGTTGCTGTGGGCTTGCT INSR AF111857 F: CAAACGGTGACCAAGCCTCA 186 R: CATCCTGCCCATCAAACTCCG POMC NM_001031098 F: CGCTACGGCGGCTTCA 88 R: TCTTGTAGGCGCTTTTGACGAT NPY, neuropeptide Y; CRH, corticotropin-releasing hormone; INSR, insulin receptor; POMC, proopiomelanocortin.
Protective effects of leptin during the suckling period against later obesity may be associated with changes in promoter methylation of the hypothalamic proopiomelanocortin gene.
The good news is that having worked out the cause of the problem - the under-production of proopiomelanocortin peptides by a sub-set of brain cells - researchers think it will soon be possible to develop drugs to "jump-start" the lazy neurons.
CRH is then transported to the anterior pituitary gland that synthesizes proopiomelanocortin (POMC), a key factor for stress hormones including ACTH and betalipotropin.
Voluntary Alcohol Drinking Enhances Proopiomelanocortin Gene Expression in Nucleus Accumbens Shell and Hypothalamus of Sardinian Alcohol-Preferring Rats.
Obesity due to proopiomelanocortin deficiency: three new cases and treatment trials with thyroid hormone and ACTH4-10.
Adiponectin receptors are expressed in hypothalamus and colocalized with proopiomelanocortin and neuropeptide Y in rodent arcuate neurons.
2003) Prenatal or neonatal Hypermethylation of overfeeding: rapid early weight proopiomelanocortin promoter gain, metabolic syndrome (Plagemann et al.