PSBA

AcronymDefinition
PSBAPennsylvania School Boards Association (Mechanicsburg, PA)
PSBAPennsylvania State Beekeepers Association (Canton, PA)
PSBAPuget Sound Beekeepers Association
PSBAProperty Stock and Business Agents (Australia)
PSBAPhilippine School of Business Administration (Manila and Quezon City, Philippines)
PSBAPlastic Surgical & Burns Anaesthetists (now Association of Burns and Reconstructive Anaestheists)
PSBAPlatinum Small Business Alliance
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Despite being a working student, Berja regularly topped PSBA's accountancy exams and was considered one of the school's best bets to top the board exam for Certified Public Accountants.
'So, rather than compelling students to go to a school because the free SHS funds will be sent there, as the case is currently, under the proposed PSBA, the money will follow the student to his or her chosen school,' he said.
Keystone and the PSBA partnered in 2018 to offer the first annual Safety Grant as an opportunity to improve safety of fleet operations or services provided to employees or students.
Molecular diversity of dinoflagellate symbionts of Cnidaria: the psbA minicircle of Symbiodinium.
The three non-coding regions of the chloroplast DNA were amplified from genomic DNA using primers for ccmp2 (ccmp2 F (GATCCCGGACGTAATCCTG), ccmp2 R (ATCGTACCGGAGGGTTCGAAT), [T.sub.a] 55 C) (Weising and Gardner, 1999), [trnS.sup.UGA] -[trnfM.sup.CAU] ([trnS.sup.UGA] (GAGAGAGAGGGATTCGAACC), [trnfM.sup.CAU] (CATAACCCTGAG GTCACGGG), [T.sub.a] 55 C), and [trnH.sup.GUG] - psbA ([trnH.sup.GUG] (CGCGCATGGTGGATTCACAATCC), psbA (GTTATGCATGAACGTAATGCTC), [T.sub.a] 66 C) (Shaw el al., 2005).
The event is being organized by National Headquarters Pakistan Boy Scouts Association (PSBA).
Pakistan Ship Breakers Association (PSBA) welcomed the government's decision to impose 15% Regulatory Duty (RD) on the import of all steel billets steel bars and wire rods at a time when the country's steel industry is trying its survival in the face of international competition.
El espaciador intergenico del trnH-psbA se amplifico usando los oligonucleotidos psbA (5 GTTATGCATGAACGTAATGCTC 3') y trn[H.sup.GUG] (5'CGCGCATGGTGGATTCACAATCC 3') (Hamilton, 1999) y el siguiente perfil termico: 80 [grados]C por 5min, (94 [grados]C por 30 s, 56 [grados]C por 40 s, 72 [grados]C por 1 min) por 35 ciclos, 72 [grados]C por 10 min.
Quantitative real time PCR analysis revealed an exchange of the psbA transcription within 30 minutes of high light conditions (500 [micro]E).
Wang, "Molecular evolution of psbA gene in ferns: unraveling selective pressure and coevolutionary pattern," BMC Evolutionary Biology, vol.