QGE

(redirected from Quantitative Gene Expression)
AcronymDefinition
QGEQuantitative Gene Expression
QGEQuad GigaSwift Ethernet (computing)
QGEQueen's Gurkha Engineer (Malaysia)
References in periodicals archive ?
Quantitative Gene Expression. NF[kappa]B gene expression was significantly (p < 0.05) increased in SMEs from the control group in comparison with the SMEs of the control plus LPS group and those SME groups treated with both PRG supernatants at different concentrations (Figure 2).
The quantitative gene expression analysis of the corresponding tissues reflects the pattern of immunohistochemistry, with strong PEDF mRNA expression in osteophytic cartilage (OC), bone (B), and periarticular mesenchyme, but virtually no PEDF mRNA expression in healthy articular cartilage (AC) (Figure 1(d)).
Neutelings, "Selection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.)," BMC Plant Biology, vol.
Accession number miRBase ID Mature miRNA sequences Size (5; [right arrow] 3;) (bp) miRBase MIMAT0000075 hsa-miR-20a-5p UAAAGUGCUUAUAGUGCAGGUAG 23 MIMAT0000080 hsa-miR-24-3p UGGCUCAGUUCAGCAGGAACAG 22 MIMAT0000255 hsa-miR-34a-5p UGGCAGUGUCUUAGCUGGUUGU 22 MIMAT0004517 hsa-miR-106a-3p CUGCAAUGUAAGCACUUCUUAC 22 MIMAT0001541 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU 22 NCBI NR.002752 RNU6B CGCAAGGAUGACACGCAAAUUC 42 GUGAAGCGUUCCAUAUUUUU TABLE 2: Primers sequences for quantitative gene expression analysis.
Quantitative gene expression assays for excision repair (ERCC1), thymidine phosphorylase (TYMP), stathmin (STMN1), ribonucleotide reductase (RRM1) and other genes provide valuable information to help predict chemotherapy responses.
Lau, "In-depth cDNA library sequencing provides quantitative gene expression profiling in cancer biomarker discovery," Genomics, Proteomics and Bioinformatics, vol.
PCR-based calibration curves for studies of quantitative gene expression in human monocytes: development and evaluation.
Applied Biosystems launched its Assays-on-Demand, which initially consists of 77,000 assays for SNP genotyping and 4,400 assays for quantitative gene expression analysis ...
The licensing and supply agreement between Incyte and Agilent allows Agilent to use Incyte's extensive portfolio of patented and proprietary gene transcripts, LifeSeq Gold human sequence database, ZooSeq animal model database, and sequence-verified cDNA clones to develop and commercialize high quality cDNA microarrays to perform sensitive and quantitative gene expression analysis.
Quantitative gene expression profiling in formalin-fixed, paraffin-embedded tissues using universal bead arrays.
Hence, for quantitative gene expression measurements based on reverse transcription to be comparable among laboratories, the same enzyme, priming strategy, and experimental conditions must be used.
The general principle of combining tailed PCR primers with universal probes has been introduced for other genetic applications, such as single-nucleotide polymorphism genotyping (14,15) and in situ amplification (16), but these methods have not been applied to quantitative gene expression studies.
Full browser ?