QPCR

(redirected from Quantitative polymerase chain reaction)
Also found in: Wikipedia.
AcronymDefinition
QPCRQuantitative Polymerase Chain Reaction
References in periodicals archive ?
Real-time quantitative polymerase chain reaction is an extremely sensitive, accurate, reproducible, and rapid technique to measure mRNA levels (Bustin 2000, 2002, Huggett et al.
mRNA expressions were determined by real-time quantitative polymerase chain reaction analysis (RT-qPCR; top) and RT-PCR (bottom) in a variety of tissues from the Thoroughbred horse.
Quantitative polymerase chain reaction primers of matrix metalloproteinase 1 (MMP-1) (Forward: TCGATGCTGCTCTTTCTGAG, Reverse: GATAACCTGGATCCATAGATCGTT), MMP-2 (Forward: TGCTGGAGACAAATTCTGGA, Reverse: GATGGCATTCCAGGCATC), tissue inhibitor of metalloproteinase 1 (TIMP1) (Forward: TTTGTGGCTCCCTGGAACAG, Reverse: CATTCCTCACA GCCAACAGTGT), TIMP2 (Forward: GAAGGAGCCCCATCAATCCT, R: CTCCCATTTCTACAAGGCTCAGA) were also designed using Primer Premier 6.0.
Gut microbiota composition was analyzed from fecal samples assessed at 1 and 6 months of age by quantitative polymerase chain reaction, 16S rRNA pyrosequencing, and denaturing gradient gel electrophoresis.
Following reverse transcription, the cDNA was used as template for amplification of CC chemokine ligand 3 (CCL3) and GAPDH sequences using the SYBR FAST quantitative polymerase chain reaction (PCR) master mix (KAPA Biosystems, MA, USA) following the manufacturer's protocol.
To study the occurrence of Chlamydia spp and their genetic diversity, we analyzed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp were not detected in wild birds; however, 4 species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae, and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes, n = 2; Piciformes, n = 2; Anseriformes, n = 1; Galliformes, n = 1; Strigiformes, n = 1).
In this study we used fluorescent quantitative polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) to detect VEGF level in the peripheral blood of patients with PIH and investigated the participation of VEGF in PIH incidence.
The investigators conducted two MERS-CoV reverse transcription quantitative polymerase chain reaction (RT-qPCR) tests on the samples, and retested the ones that were positive.
Using quantitative polymerase chain reaction procedures, the team also identified three regulatory defense genes whose activity was higher in treated plants than in untreated ones.
Telomere length was determined using quantitative polymerase chain reaction testing.
Substrate modified by DNA polymerase serves as a target for a quantitative polymerase chain reaction (qPCR).
DermTech develops qPCR (quantitative polymerase chain reaction) assays for skin samples collected non-invasively using adhesive tape biopsy methods.
Full browser ?