RAP1

AcronymDefinition
RAP1Rhoptry-Associated Protein 1
RAP1Repression Activator Protein 1
References in periodicals archive ?
Cell motility in chronic lymphocytic leukemia: defective Rap1 and [alpha]L[beta]2 activation by chemokine.
Epac1 Agonist Treatment Led to Increased Rap1 and Decreased p38 MAPK and JNK.
However, to validate our model, we only consider activity in the random AP1 (RAP1) (accecibale by all the U[P.sub.i]), and assumed other optional AP's to be null.
In this paper, only the RAP1 and one MAP are adopted to compose the superframe in the beacon-enable mode.
Altman, "SLAT promotes TCR-mediated, Rap1-dependent LFA-1 activation and adhesion through interaction of its PH domain with Rap1," Journal of Cell Science, vol.
Gene Primer (5' [right arrow] 3') Annealing temperature ([degrees]C) [beta]-Actin F CCTCATGCCATCCTGCGTCTG 58 R TTGCTCGAAGTCTAGGGCAACATAG TRF1 F AAGTCCTGAAAGCCCTGAATC 58 R TTCCTGTGCCTCCAAAATCT TRF2 F CTGTATTCATTTTGCTAACTTAG 55 R ATTCTTAACACTCTCTAGAGTTG TIN2 F CTTCATTCCTACTAAACTACTTG 57 R ACTGTAGAGACAGTTCTAGACCT POT1 F CAGAAAAGTGTGGATATG 55 R AAGTAAAAGAAGTGTGGG TPP1 F GCGTGACGTCTCACATCG 55 R ATCGTGATGGTTCTGCCTTC RAP1 F TGTGGTGTGTGTGTGTGTGG 50 R CCCCACACACACCACACAC Table 2: Clinical and demographic parameters of patients participating in the study.
Boyer, "Activation of Rac1 by paxillin-Crk-DOCK180 signaling complex is antagonized by Rap1 in migrating NBT-II cells," Journal of Biological Chemistry, vol.
Various known tumor-associated genes (bcl2, MALT1 and DCC at 18q21; and RAP1 at 4q21) and a gene related to the embryogenesis of gonads such as H-Y regulator gene at Xp22.3 are located at or near the translocation breakpoints.
Washington, June 21 ( ANI ): Researchers have discovered that RAP1, a gene that protects telomeres- the ends of chromosomes, has a key role in obesity.
The protein expressed by RAP1 gene is a small GTPases which belongs to the RAS super-family and shows 50% amino acid sequence homology with RAS (5).