RGPE

AcronymDefinition
RGPERanking Group Entry
RGPEReseau Girondin Petite Enfance (French: Cultural Awakening Early Childhood)
References in periodicals archive ?
mutans genotype k was identified by conventional PCR using a set of specific primers CEFK-F and KR based on the sequence of genes rgpF and rgpE (Table 1) and the PCR conditions previously described.
Primers and control strains used in the PCR reactions Primers Sequence (5' to 3') Target Size (bp) GTFB-F ACTACACTTTCGGGTGGCTTGG 0Q CD 517 GTFB-R CAGTATAAGCGCCAGTTTCATC GTFI-F GATAACTACCTGACAGCTGACT gfi 712 GTFI-R AAGCTGCCTTAAGGTAATCACT SC-F CGGAGTGCTTTTTACAAGTGCTGG rgpH 727 SC-R AACCACGGCCAGCAAACCCTTTAT SE-F CCTGCTTTTCAAGTACCTTTCGCC ORFe3 517 SE-R CTGCTTGCCAAGCCCTACTAGAAA SF-F CCCACAATTGGCTTCAAGAGGAGA ORF2f 316 SF-R TGCGAAACCATAAGCATAGCGAGG CEFK-F ATTCCCGCCGTTGGACCATTCC rgpE 294 K-R CCAATGTGATTCATCCCATCAC and rpgF Eubac AGAGTTTGATCCTGGCTCAG 16S rRNA 1500 27F 1492R GGTTACCTTGTTACGACTT 16S rRNA Primers Control Strain Reference GTFB-F S.