RIII

AcronymDefinition
RIIIRural Infrastructure Investment Initiative (Canada)
References in periodicals archive ?
In RIII and C57BL/6J, we observed a characteristic PrP deposition in the CA2 region of the hippocampus, whereas VM exhibited PrP deposition in the molecular dentate gyrus with occasional small plaques present in the corpus callosum (online Technical Appendix Figure 1, https://www.nc.cdc.gov/EID/article/23/9/170159-Techappl.pdf).
Organization of the human T cell receptor zeta/eta gene and its genetic linkage to the Fc gamma RII-Fc gamma RIII gene cluster.
Product Refer- Target Primer Sequence size (bp) ence mecA F AAAATCGATGGTAAAGGTTGGC 533 [2] R AGTTCTGCAGTACCGGATTTG [beta]F ATTGCCTTGATAATAGCCYTCT 937 [alpha]3R TAAAGGCATCAATGCACAAACACT ccRCF CGTCTATTACAAGATGTTAAGGATAAT SCCmec ccRCR CCTTTATAGACTGGATTATTCAAAATAT 518 [3] 1272F1 GCCACTCATAACATATGGAA 1272R1 CATCCGAGTGAAACCCAAA 1415 5RmecA TATACCAAACCCGACAACTAC 5R431 CGGCTACAGTGATAACATCC 359 Agr PanF ATGCACATGGTGCACATGC RI GTCACAAGTACTATAAGCTGCGAT 439 [20] RII GTATTACTAATTGAAAAGTGCCATAGC 572 RIII CTGTTGAAAAAGTCAACTAAAAGCTC 406 RIV CGATAATGCCGTAATACCCG 659 Spa 1113F TAAAGACGATCCTTCGGTGAGC Variable [22] 1514R CAGCAGTAGTGCCGTTTGCTT Table 2: Correlation between the different molecular typing methods.
Zurkurnai et al., "Plasmodium falciparum: increased proportion of severe resistance (RII and RIII) to chloroquine and high rate of resistance to sulfadoxinepyrimethamine in Peninsular Malaysia after two decades," Transactions of the Royal Society of Tropical Medicine and Hygiene, vol.
Joseph) and Rhode Island Hospital (RIII) as the defendants allegedly responsible for the actions or inaction which occurred prior to the death of her husband in January of2002.
In cyclopoid copepods, the urosome was the preferred region (RIII) followed by the metasome (R II).
The automaker is also launching its new Dzire, and a new multipurpose vehicle named RIII.
The lightening system was a source of regulated light DCR RIII FOSTEC.
This includes a new small-car in the Alto segment, mostly developed by its local R&D team, and a 'Toyota Innova-type' MPV possibly based on the RIII concept.
The inspection report documenting this issue and the NRC's final decision will be available through the NRC RIII Office of Public Affairs and at NRC's website at http://www.nrc.gov/readingrm/ adams/web-based.html.
Modulation of CD16 on infected neutrophils: The expression of CD16 (a low affinity Fc gamma RIII) which is expressed at high level on resting PMN, and its modulation after infection were analysed.