ROSECRolls Smiths Engine Controls Ltd
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
aureus ENTEROTOXIGENICOS E RESPECTIVOS PRODUTOS DE AMPLIFICACAO Primers Sequencia 5' [right arrow] 3' Posicao Produto de no gene amplificacao (pb) ESA1 ACGATCAATTTTTACAGC 203 a 222 544 ESA2 TGCATGTTTTCAGAGTTAATC 726 a 746 ESB1 GAATGATATTAATTCGCATC 621 a 640 416 ESB2 TCTTTGTCGTAAGATAAACTTC 1015 a 1036 SEC1 GACATAAAAGCTAGGAATTT 676 a 695 257 SEC2 AAATCGGATTAACATTATCCA 912 a 932 SED1 CAAATATATTGATATAATGA 4 a 23 330 SED2 AGTAAAAAAGAGTAATGCAA 314 a 333 femA1 AAAAAAGCACATAACAAGCG 1444 a 1463 132 femA2 GATAAAGAAGAAACCAGCAG 1556 a 1575 Primers Referencia ESA1 Rosec e Gigaud (2002) ESA2 ESB1 Rosec e Gigaad (2002) ESB2 SEC1 Najera-Sanchez et al.
A ocorrencia de enterotoxinas estafilococicas tem sido constatada com frequencia em produtos lacteos, especialmente em queijos, envolvidos ou nao em surtos e casos esporadicos de intoxicacao (CARMO et al., 1995; ROSEC et al., 1997; CARMO et al., 2002; NORMANNO et al., 2005).