RPLR

AcronymDefinition
RPLRRetail Prime Lending Rate
RPLRRecreation and Parks Law Reporter (quarterly publication)
RPLRRepeller
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
This is the second time in three months that HDFC has reduced its RPLR. With this reduction the RPLR has been brought down by 100 basis points since December 2008.
Primer for quantitative real-time reverse transcription PCR Gene Primer sequence (5' [right arrow] 3') Complement component CD AAGGAGGGGGCACACTATCT TGCGTGGACAGTGTGTATGA Phosphatidylethanolamine CTGACCACTCAGGGCTTAGG binding protein ATTCAAGGTGGCCTCTTTCC ATP synthase F0 TTGTTAGTAGGATTAGAATGGTGAATG CTGGAACACCCACTCCACTAA Insulin-like growth factor CTTGTTTCCAAGCAGTGCAG binding protein 3 CCTCCACTTCATGCCTTAGC RPLR gene (Internal control) CAA CCC TGA AGT GCT TGA CAT AGG CAG ATG GAT CAG CCA Table 2.
Mumbai: Ahead of the Reserve Bank's monetary policy announcement, mortgage lender HDFC Monday increased its retail prime lending rate (RPLR) by 10 basis points with immediate effect.
The increase in the Retail Prime Lending Rate (RPLR), on which it benchmarks the Adjustable Rate Home Loans (ARHL), is effective from April 1, an official statement said.