SAA2

AcronymDefinition
SAA2Serum Amyloid A Protein 2
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The SAA baseline concentration was quantified by using a sandwich ELISA and the CNVs of SAA1 and SAA2 were determined by using the Type-it CNV SYBR Green PCR Kit (Qiagen) (5).
A strong correlation between SAA1 CNVs and SAA concentration was found (r = 0.321, P < 0.001) as well as between SAA2 CNVs and SAA concentration (r = 0.406, P < 0.001) (Fig.
In addition, nearly 40% of individuals with [less than or equal to] 3 copies of SAA1 and over 20% of individuals with 1 copy of SAA2 were overlapped in the study group (data not shown).
The human SAA gene is found on the short arm of chromosome 11, restricted to band p15.1, consists of four related genes, SAA1-4, within a 150-kb region.10 Only the SAA1 and SAA2 genes encode acute-phase SAAs (SAA1 and SAA2 proteins), so many studies emphasize on them.
In this study, we determined the extent to which acute phase SAA1.1 and SAA2.1 contribute to this impairment by quantifying in vivo macrophage RCT in wild-type (WT) and SAAKO mice in the presence or absence of LPS-elicited endotoxemia.
Mice lacking SAA1.1 and SAA2.1 were generated by targeted deletion of both mouse acute phase SAA genes SAA1 and SAA2 (InGenious Targeting Laboratory Inc., Stony Brook, NY) using embryonic stem cells derived from C57BL/6 x 129 SVEV mice as described previously [13].
Mice Deficient in SAA1.1 and SAA2.1 Mount a Normal LPS-Induced Acute Phase Response.
The following specific primers were used: SAA1 (forward 57-CCTGGGCTGCAGAAGTGATCAGCGA-3' and reverse 5' -AGTCCTCCG-CACC-ATGGCCAAAGAA-3') (NM_199161.2), SAA2 (forward 5'-CTGGGCCGCAGAAGTGA-TCAGCA-3' and reverse 5'-G AGTCCTCCGCACCATGGCCTG T-3') (NM_030754.3), SAA4 (forward 5'-GTTCGTTTTTCAAGGAGGCTCTCCAA-3' and reverse 5'-GGATATCATTATGTCCCAATAGGCTCT-3') (NM.006512.2), MMP-2 (forward 5,-GACTACGACCGCGACAAGA-37 and reverse 5'-TGTTGCCCAGGAAAGTGAA-3') (NM.004530.4), MMP-9 (forward 5'-GAGGTGGACCGGATGTTCC-3' and reverse 5'-AACTCACGCGCCAGTAGAAG-3') (NM_ 004994.2), and Tubulin (forward 57-TCAACACCTTCTTCAGTGAAACG-3' and reverse 5'-AGTGCCAGTGCGAA-CTTCATC-37) (NM_006082.2), which was used as a constitutive control.
Because SAA is an acute-phase protein predominantly expressed and produced in the liver in response to inflammation, we tested whether these glioma cells express and produce the isoforms SAA1, SAA2, and SAA4 in basal conditions.
The top three upregulated genes Orm1 (3.7-fold), Cp (2.9-fold), Saa2 (2.6-fold), in addition to C4b (2.1-fold), Orm2 (2.27-fold), and Saa1 (2.3-fold) are classified as acute-phase proteins (Figure 3).
Acute-phase SAA is divided into two major isotypes, SAA1 and SAA2, which are coded at different loci.