SCD1

AcronymDefinition
SCD1Stearoyl CoA (Coenzyme A) Desaturase 1
SCD1Stearoyl CoA Desaturase 1
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Statins and liraglutide inhibit adipogenesis while niacin and fibrates stimulate, by inducing upregulation of adipogenesis genes (* leptin; adiponectin, FABP4, perilipin, and GLUT4, SCD1) expression and (B) immune and endocrine functions of WAT.
Rial et al., "Hepatic BSCL2 (Seipin) deficiency disrupts lipid droplet homeostasis and increases lipid metabolism via SCD1 activity," Lipids, vol.
Among these genes were key regulators and enzymes in adipocyte lipogenesis: Both SCD1 and ACC are regulated by the transcription factor SREBP-lc.
Gene Primer sequence (5' [right arrow] 3') Srebp1c F GGAGCCATGGATTGCACATT R GCTTCCAGAGAGGAGGCCAG Acc1 F CCTCCGTCAGCTCAGATACA R TTTACTAGGTGCAAGCCAGA Fasn F TGGGTTCTAGCCAGCAGAGT R ACCACCAGAGACCGTTATGC Scd1 F GGAGAGAATTTCATCTTCCA R CTTCCCAAAGCGGTGTGAGT Beta-actin F GAGACCTT CAACACCCCAGC R ATGTCACGCACGATTTCCC
mRNA expression levels for (a) CD36, (b) ChREBP, (c) SREBP1c, (d) ACC, (e) FAS, and (f) SCD1 in the livers of NTg and apoCIII mice fed either a low-fat (LF) or high-fat (HF) diets were analyzed and normalized to [beta]-actin (n = 6-8).
By studying the lipogenesis related gene, we found that FASN dramatically downregulated in all HFHC diet groups, while the expression of SCD1 increased in model groups.
Ecelbarger, "Chronic rosiglitazone therapy normalizes expression of ACE1, SCD1 and other genes in the kidney of obese zucker rats as determined by microarray analysis," Experimental and Clinical Endocrinology and Diabetes, vol.
This treatment significantly inhibited the expression of SCD1 and SREBF1, which mediate lipogenesis, and tended to decrease expression of ACACA (Fig.
Association between the polymorphism of the goat stearoyl-CoA desaturase 1 (SCD1) gene and milk fatty acid composition in Murciano-Granadina goats.
(17-19) The connection may be related to an enzyme known as SCD1 (stearoyl-CoA desaturase 1).
The enzyme, called SCD1, converts saturated fat into monounsaturated fat, which is easier to metabolize.
"What we found in those animals is they had a hypermetabolic rate compared to the wild mice, increased energy consumption and greatly increased these animals' exercise capacity." The enzyme, called SCD1, converts saturated fat into monounsaturated fat, which is easier to metabolize.