SEC2


Also found in: Medical.
AcronymDefinition
SEC2Security Specialist Level 2 (law enforcement)
SEC2Staphylococcus Aureus Enterotoxin C2
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
role rserver (RC, Ui, ASj: agent, SKeyl : symmetric_key, SKey2 : symmetric_key, H, MUL, SUB: hash_func, Snd, Rcv: channel(dy)) played_by RC def= local State : nat, IDj, IDi, Ej, P, Q, N, W, Dj, G, Yj: text, Ai, Bi, Ci, Di, Ei, Fi, X, M1, M2, M3: message, Inc : hash_func const user_rserver, rserver_aserver, aserver_user, sec1, sec2, sec3, sec4, sec5, sec6 : protocol_id init State :=0 transition I.
[19] The Certicom Corporation, SEC2: Recommended elliptic curve domain parameters, 2000.
SEC2, 2000, available at http://www.secg.org/collateral/sec2.pdf.
aureus ENTEROTOXIGENICOS E RESPECTIVOS PRODUTOS DE AMPLIFICACAO Primers Sequencia 5' [right arrow] 3' Posicao Produto de no gene amplificacao (pb) ESA1 ACGATCAATTTTTACAGC 203 a 222 544 ESA2 TGCATGTTTTCAGAGTTAATC 726 a 746 ESB1 GAATGATATTAATTCGCATC 621 a 640 416 ESB2 TCTTTGTCGTAAGATAAACTTC 1015 a 1036 SEC1 GACATAAAAGCTAGGAATTT 676 a 695 257 SEC2 AAATCGGATTAACATTATCCA 912 a 932 SED1 CAAATATATTGATATAATGA 4 a 23 330 SED2 AGTAAAAAAGAGTAATGCAA 314 a 333 femA1 AAAAAAGCACATAACAAGCG 1444 a 1463 132 femA2 GATAAAGAAGAAACCAGCAG 1556 a 1575 Primers Referencia ESA1 Rosec e Gigaud (2002) ESA2 ESB1 Rosec e Gigaad (2002) ESB2 SEC1 Najera-Sanchez et al.
Available at http://w,ww.medpac.gov/publications/congressional_reports/Jun04Databook Sec2.pdf
422, Sec2, Tian Jung lang, Rd., Sihu Township, Changhua County, 51443
SEC is a set of binary variables for section within a semester (SEC1 and SEC2, respectively for first and second sections)