SMAI

AcronymDefinition
SMAISociete de Mathematiques Appliquees et Industrielles (French)
SMAIStyrene Maleic Anhydride Imide (resin)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
However, "it also means union, and there are Smai depictions throughout the temple walls in ancient Egypt.
SMAI considers both the soil moisture condition at the current month and that of the previous month.
The DNA corresponding to PpPBP(CP-TG)-AnaPBP(TP)-PpPBP(C), called PpPBP-AnaTP, was amplified from the plasmid using the PpPbp-Met-F and PpPbp-13R-SphI primers, subjected to blunting and kination, and inserted into the SmaI site between the rice actin promoter and rbcS gene terminator of the pTKM1 vector.
Zeytouninan, Modelisation Asymptotique en Mecanique des Fluides Newtoniens, Collection SMAI, Springer, Berlin, Germany, 1994.
Restriction of the genomic DNA was achieved with 25U of SmaI (Sigma, Steinham, Germany) for 2h at 30[degrees]C.
monocytogenes strains was determined by PFGE of DNA digested with the restriction enzymes ApaI and SmaI, and electrophoresed on a Chef DRII system (Bio-Rad Laboratories, Hercules, CA).
A analise por PFGE de 95 linhagens utilizando a enzima SmaI revelou a ocorrencia de cinco perfis eletroforeticos ou pulsotipos (Tabela 1).
The ITS1 assay (Baxter et al., 1997) makes use of the presence of a diagnostic restriction site sequence, recognized by the restriction enzyme SmaI (Pleyte et al., 1992; Baxter et al., 1997), that is present in bull trout but absent in Dolly Varden.
Primers Primers sequences (5'-3') Underlined names enzymatic sites inCHI31-R ATCGGGTACCAGGAGCAGTGCGGTTCTCAAGCCGGT KpnI inCHI31-L CGATGAGCTCAGCAAAAGGCCTCTGGCTATTGC SacI inCHI32-R ATCGCCCGGGCTGGACCTGACGGACCAGCTCGTT SmaI inCHI32-L CGATGGATCCTGTGACGATGCAGAGCCGGATGGGTT BamHI exCHI31-R ATCGGAAGACTGCATG AAAACGACACT CAT CCTAACCG BbsI exCHI31-L CGATGGTACCTCAAGCAAAAGGCCTCTGGCTATTG KpnI exCHI32-R ATCGCCATG GGGAGGCATTGGAGACTGGTAATC NcoI exCHI32-L CGATGGTACCTCAATTATGACGATGCAGAGCCGGAT KpnI
C'est ainsi que sont programmes les films "La danse orientale, de Amine Smai" (Maroc), "Normale, de Merzak Allouache" (Algerie), "Syria's Cyber revolution d'Annasofie Flamand et Hugh Macleod" (Syrie), "Tahrir, Place de la liberation de Stefano Savona (Egypte), "les femmes et la revolution de Nicolas Henin, Wissam Charaf et Benjamin Wiaceck" (Yemen), et "Laicite Inchallah, de Nadia El Fani (Tunisie).
We were a group of young men (seven or more) from Kerma; those I remember are: Abu Haurira, my friend of 16 years, Yahya Abdel Hamied, Mohamed Al Hadi, Mohamed Hassan, Dya Al Dein Abdel Wahab and Smai Naser.
Smai shone with a sterling knock and Umar Waheed smashed exact unbeaten 100 runs to propel home side to mammoth 388 for 2 in allotted 50 overs.