SSAL

AcronymDefinition
SSALSilver Star Auto Ltd. (est. 1996; Ghana)
SSALSpecial Structural Adjustment Loan (World Bank)
SSALSmall School Athletic League (New York)
SSALSouth Shore Area Local (American Postal Workers Union; Brockton, MA)
SSALSecretion System Apparatus Protein
SSALSea Shepherd Australia Limited
SSALScottish Survey of Adult Literacies (Scotland, UK)
SSALStainless Steel Airpot with Lever Lid (various companies)
SSALStellar Solutions Aerospace Limited (UK)
SSALSmart Structures and Acoustic Laboratory (University of Massachusetts Lowell)
SSALStrategic Sea and Airlift (military term)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
(WY3Y5) Inputs (X) Student teacher ratio (STR) 17.20 2.69 Student support staff ratio (SSTR) 95.61 35.17 Average contract salary for teachers ($) (TSAL) 107,769 9507 Average contract salary for support staff ($) 75,873 20,836 (SSAL) Teaching experience (Years) (EXPR) 15.98 4.57 Student enrolment (FTE) (ENROL) 332 188 Total expenditure per student ($) (TEXPND) 10,175 2737 Socio-economic Variables (Z) Enrolled in English as a second language (%) 23.83 27.43 (ESL) Aboriginal students (%) (ABOR) 6.56 10.04 Special education students (%) (SPLED) 4.34 4.52 Parental socio-economic index (ICSEA) 1005 92 Secondary Schools (Observations = 1113) Output (Y) Weighted Composite Score for 7th 553 44.23 and 9th Gr.
Posteriormente, todas las cepas fueron sometidas a otro proceso de transformacion, con los productos amplificados con los iniciadores disenados para la mutagenesis: SPI1/invF-H1P1 y SPI1/invA-H2P2, SPI2/ssaI-H1P1 y SPI2/ ssaL-H2P2, los cuales amplifican el gen de resistencia a la Km del pKD4 y reconocen las secuencias externas flanqueantes de la region genica, invF - invA y ssaH/ssaI - ssaL, de los genes invG/invE de la SPI-1 y los genes ssaJ/ ssaK de la SPI-2, respectivamente.
Iniciadores usados para verificar la inactivacion de los genes en las SPI-1 y SPI-2 Iniciadores Secuencia SPI1/invF/ForA GCAATCGCTGCTGAATAGTG SPI1/invF/ForB CTGAAAGCCGACACAATGAA SPI1/invA/RevC CAGTGCGATCAGGAAATCAA SPI2/ ssaHI/ForA CGCTGCGTCTGTTATTTCCT SPI2/ssaG /ForB CGCAATTTGCCTTACAGCAG SPI2/ssaL/RevC TATCCACTTCGCCAAGTTCC pKD4-K2 CGGTGCCCTGAATGAACTGC pKD4-Kt CGGCCACAGTCGATGAATCC Las secuencias fueron obtenidas de las regiones flanqueantes de los genes invF, invA, ssaH, ssaI, ssaG y ssaL en sentido forward o reverse (figura 2), pKD4-K2 y pKD4-Kt corresponden a la region codificante para el gen kanamicina del plasmido pKD4 en sentido forward K2 y reverse Kt.
(8) Kim Richard No ssal, The Politics of Canadian Foreign Policy (Scarborough: Prentice-Hall, 1997) at 177 [Canadian Foreign Policy].
We assayed variation at two variable number tandem repeat (VNTR) loci in sockeye salmon and kokanee by hybridization with two minisatellite repeat sequence probes, "Ssal-rep" (Ssal) and "3.15.34" (T34).
These standards were two fish possessing the most common alleles at Ssal and T34 (range of allelic molecular weights were 0.8-5.1 kilobase pairs, kbp).
Continued propagation of yeast prions requires the presence of several chaperone proteins in yeast cells, including the Hsp104 protein and the Ssal protein.
A simplified short approach lighting system (SSALS) was fitted on Runway 19, but this will be upgraded this spring to bring it up to SSALS with runway alignment indicator standard.
Therefore, MALSR and SSALR are 2400-feet long, while SSALS, SSALF, MALS, MALSF are 1400.
(3) VOR, VOR/DME, TACAN, LOC, LOC/DME, LDA, LDA/DME, SDF, SDF/DME, GPS, ASR and RNAV (LNAV/VNAV and LNAV line of minima) Inoperative Visual Aid Approach Category Increase visibility ALSF 1 & 2, MALSR, & SSALR ABCD 1/2 mile SSALS,MALS, & ODALS ABC 1/4 mile Along those lines, DME is often used to identify step-down fixes and as a result many approaches have a note "DME Required." If the DME is NOTAM'd out, then the approach might be considered NA.
A simple, short, 1400-foot array with nothing else is SSALS and, in medium intensity, is MALS.