SLZ

AcronymDefinition
SLZSan Lawrenz (postal locality, Malta)
SLZSao Luiz, Maranhao, Brazil - Tirirical (Airport Code)
SLZSesia-Lanzo Zone (geology; Italy)
SLZSonce, Luna in Zemlja (Slovenian: Sun, Moon and Earth; astronomy)
SLZStar Light Zone (Sonic 1 level)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The oligonucleotides with sequences of 5'-TCT[CTCGAG.bar]A AAAGAGAGGCTGAAGCTAAGGTCTTTGAGAGATGT GA-3' and 5'- CTG[TCTAGA.bar]TCACACTCCACAACCC TGAATG-3' were designed based on the open reading frame of the SLZ (GenBank accession No.
As a basis for functional and structural studies, the SLZ cDNA was successfully expressed in P.
pastoris GS115 was corresponded very well to the theoretical molecular mass of 14.5 kDa based on the cDNA sequence of SLZ (Figure 2).
0.068 0.317 Dietary Supplement A (IU/kg) D (IU/kg) S[L.sub.1] (mm) SLZ (mm) 0 0 16.03 (ab) 20.29 (e) 500 16.59 (ab) 21.87 (bcde) 1,000 17.34 (ab) 22.78 (abcd) 5,000 17.22 (ab) 23.07 (abcd) 1,000 0 16.41 (ab) 21.09 (cde) 500 17.47 (ab) 23.35 (abc) 1,000 17.36 (ab) 23.55 (abc) 5,000 17.92 (a) 24.20 (a) 100,000 0 16.87 (ab) 21.70 (bcde) 500 17.10 (ab) 22.87 (abed) 1,000 17.76 (ab) 23.82 (ab) 5,000 17.44 (ab) 23.65 (abc) 1,000,000 0 15.84 (b) 20.26 (e) 500 16.68 (ab) 21.58 (cde) 1,000 17.03 (ab) 22.17 (abcde) 5,000 16.81 (ab) 21.95 (bcde) ANOVA A 0.024 0.000 D 0.000 0.000 A x D 0.925 0.831 Pooled s.e.
The shares were sold at USD1.30 per share to funds managed by SLZ Capital Management LLC in a privately negotiated, unsolicited sale.
The combination of MTX + SLZ is also recommended for patients with active disease independent of disease duration and prognostic factors.
According to the ACR 2008 guidelines for the use of biological and non-biological DMARDs, two-drug combinations (MTX + HCQ, MTX + LEF, or HCQ + SLZ) were recommended for RA patients with moderate or high disease activity independent of prognostic factors (Evidence level: B).