TACMAN

AcronymDefinition
TACMANTactical Manual
References in periodicals archive ?
This event resulted in a NATOPS change due to a typo in the CH-53E NATOPS manual leading to a discrepancy with the ANTTP (TACMAN).
Real-time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) for the measurement of prostate-specific antigen mRNA in the peripheral blood of patients with prostate carcinoma using the TacMan detection system.
(a) Forward primer b2a2 GCATTCCGCTGACCATCAATA b3a2 CCACTGGATTTAAGCAGAGTTCAA GAPDH GAAGGTGAAGGTCGGAGTC BCR TCTCCCTGACATCCGTGG [beta]-ACTIN CAACTGGGACGACATGGAGA TacMan probe b2a2 FAM-CAGCGGCCAGTAGCATCTGACTTTGA-TAMRA (b) b3a2 FAM-CAGCGGCCAGTAGCATCTGACTTTGA-TAMRA GAPDH JOE-CAAGCTTCCCGTTCTCAGCC-TAMRA BCR FAM-TGAAACTCCAGACTGTCCACAGCATTCC-TAMRA [beta]-ACTIN [FAM-ATGCCCT.sup.TAMRA]CCCCCATGCCATCCTGCGT Reverse primer b2a2 TCCAACGAGCGGCTTCAC b3a2 TCCAACGAGCGGCTTCAC GAPDH GAAGATGGTGATGGGATTTC BCR GATGACATTCAGAAACCCATAGAG [beta]-ACTIN GGTCAGGCAGCTCGTAGCTC (a) All sequences are 5' to 3'.