TCCCA

AcronymDefinition
TCCCATottori Center for Climate Change Actions (Japan)
TCCCAToronto Congenital Cardiac Centre for Adults (Canada)
TCCCATokushima Center for Climate Change Actions (Japan)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
The RT-PCR was performed immediately after RNA isolation by using the specific primer pair for CoV, Cor-FW 5' [right arrow] 3' (DNA) ACTCAAATGAATTTGAAATATGC, and Cor-RV 5' [right arrow] 3' (DNA) TCACACTTTGGATAA TCCCA that amplifies a 251-bp fragment of the polymerase gene (11).