TCDA

AcronymDefinition
TCDATexas Choral Directors Association
TCDATaylor County Development Authority (Florida)
TCDATennessee Career Development Association (National Career Development Association)
TCDATexas Career Development Association
TCDATechnical Committee on Design Automation (IEEE Computer Society)
TCDATexas Cattle Dog Association
TCDAThe Cats Demand Answers (blog)
References in periodicals archive ?
Nucleic acid amplification testing (NAAT) for tcdB and/ or tcdA uses PCR or isothermal amplification and is very sensitive for detecting toxigenic C.
Table 2 shows that 13/37 (35.1%) carried both genes of toxin A (TcdA) and B (TcdB), whereas 17/37 (45.9%) of isolates were negative for toxin A and B genes.
Pruebas de deteccion de genes, principalmente toxinas (tcdA, tcdB) mediante la amplificacion de acidos nucleicos (PCR) es una alternativa rapida, sensible y especifica.
Table 1: Primer details Gene Primer Sequence (5' [right arrow] 3') tcdA * NK11 F (5'TGATGCTAATAATGAATCTAAAATGGTAAC -3') NK9 R (5'CCACCAGCTGCAGCCATA -3') tcdA ([dagger]) NK3 F (5'GGAAGAAAAGAACTTCTGGCTCACTCAGGT-3') NK2 R (5'CCCAATAGAAGATTCAATATTAAGCTT-3') tcdB ([dagger]) NK104 F (5'GTGTAGCAATGAAAGTCCAAGTTTACGC -3') NK105 R (5'CACTTAGCTCTTTGATTGCTGCACCT -3') Annealing Gene Primer Length temp ([degrees]C) tcdA * NK11 30 55[degrees]C NK9 18 tcdA ([dagger]) NK3 30 55[degrees]C NK2 27 tcdB ([dagger]) NK104 28 55[degrees]C NK105 26 Product size Gene Primer (bp ([double dagger])) tcdA * NK11 1200bp NK9 tcdA ([dagger]) NK3 250bp NK2 tcdB ([dagger]) NK104 200bp NK105 * Repeating region, ([dagger]) Nonrepeating region, ([double dagger]) base pair.
Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (toxin A), and tcdB (toxin B) genes for toxigenic culture of Clostridium difficile.
(21) To prevent incoherence In the tariffs between SACU members, more than 50 TCDA tariff categories have had to be changed to make consistent with those negotiated by the UE with Botswana, Lesotho and Swaziland.
It is important to note that the TCDA array and its feed variations, even though conformal in nature, have been shown to deliver instantaneous bandwidth that is comparable and even greater than the nonconformal Vivaldi arrays [52, 53].
Biochemical confirmation was based on L-proline aminopeptidase activity (Pro Disc, Remel, Lenexa, KS, USA) and gene markers of toxin production (tcdA, tcdB, cdtA, cdtB, and tcdC) and tpi, cdU, tcdE, and 16S based on Lemee and Persson protocols [15,16].
The authors state that the isolates were non-BI strains characterized by the presence of the tcdA and tcdB genes.
Virulence of main factors in diseases that are currently known has two types of clostridia toxins including toxin A (TcdA, an enter toxin) and toxin B (TcdB, a cytotoxin) [8].
Clostridium difficile is a gram-positive, anaerobic, sporeforming, rod-shaped bacterium that can produce at least three toxins including two Rho GTPase-glucosylating toxins (TcdA and TcdB) and the binary C.
PCR detection of Clostridium difficile triose phosphate isomerase (tpi), toxin A(tcdA), toxin B (tcdB), binarytoxin (cdtA, cdtB), and tcdC genes in Vhembe District, South Africa.