TCGCTokyo City Guide Club (Tokyo, Japan)
TCGCTexas Color Guard Circuit (Bryan, TX)
TCGCTheological Consortium of Greater Columbus (Ohio)
TCGCTenth Cavalry Gun Club (various locations)
TCGCTates Creek Golf Course (Kentucky)
TCGCTexas Carnival Glass Club (Fredericksburg, TX)
TCGCTri-Cities Golf Course (Blountville, TN)
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
FIGURE 3 MSME's Non-Performing Loans, 2005-13 NPL TCGC MSMEs' NPL to MSMEs' Total Loans 2005 9.74 2006 14.87 2007 12.64 2008 18.9 2009 10.08 7.1 2010 6.06 5.4 2011 4.02 4 2012 3.5 2.1 2013 3.86 3.3 SOURCE: ADB (2014) and Bank of Thailand < /Financiallnstitutions/Publications/FIProformance_ Press/n3154e.pdf# search=SME%25201oans>.
MSMEs loans SOURCES: ADB (2014), TCGC (2014); Chaisiriwongsuk (2015).
Para la prueba de PCR se empleo una alicuota de 2 [micron]L del lisado (utilizado como DNA molde), a la cual se le adiciono 23 [micron]L de la mezcla maestra de PCR constituida por: 0.5 U de la enzima Phusion polymerase (Hot-Start DNA Polimerasa, Finnzyme), Phusion buffer con 200 [micron]M de trifosfatos desoxinucleosidos, 4 mM Mg[Cl.sub.2] y los primers previamente validados (Stx1: F: CTGGATTTAATGTCGCATAGTG, R: AGAACGCCCACTGAGATCATC, Amplicon 150 pb, Tm 87[grados]C; Stx2 F: GGCACTGTCTGAAACTGCTCC, R: TCGC CAGTTATCTGACATTCTG, Amplicon 255 pb, Tm 89.1 [grados]C y eaeA F: ATGCTTAGTGCTGGTTTAGG, R: GCCTTCATCATTTCGCTTTC, Amplicon 248 pb y Tm 83.4[grados]C) y el agente SYBR green I como fluorocromo para el DNA.