TCHH

AcronymDefinition
TCHHTheatre Company at Hubbard Hall
References in periodicals archive ?
RT-qPCR was used to quantify the mRNA expression of ALP, Versican, WNT5a, LEF1, [beta] catenin, P cadherin, EpCAM, TCHH, Keratin 75, Keratin 35, and Keratin 32.
Target Forward primer Reverse primer hHPRT ACCAGGTTATGACCTTGATT AAGTTGGCCTAGTTTATGTT ALP GCACCTGCCTTACTAACTCC AACATAGACACTGCCCTCATC Versican TCCAACAGGAAAGGAATGAA TTACTGGGGACAGTGAGGTG WNT5a GGGTGATGCAGATAGGTAGG TCAGGTGTAGGGACAGGAAT LEF1 TGAAGGTGATTCTTGGGTTAT CACGGGCACTTTATTTGACT [beta] Catenin CAGCAGCAATTTGTGGTAGG TAGCTCTTCAGGAAGACGGA P cadherin CACATCTGGGTTAAGGAGTT CAGGAGAAGGCACAGTCGTA EpCAM CAGCGGTTCTTTTGGCATAC TCCCCATTTACTGTCAGGTC EDAR TTGCCTCCTTTCTACTGTTGC GCTTACCTTCCACGACTCCA TCHH CTCCTTGAAAGGGAATTTGG TTCCTTGCTCTGGTCTCCTC Keratin 75 TCAAAGTCAGGTAAGTGGGAGA CAAGATGAAGGTCCTTGTGCT Keratin 35 TGCCCTGACTACCAGTCCTA TCCAAAGCCACTCTGAACCT Keratin 32 CATTTCAGGACCATTGAGGA AGTCCAGTTCCCTTCCCAGA
Hughes later went to police and denied knowing anything about the find, tchh a key f the court heard.