TGACCTherapeutic Goods Advertising Code Council (Australia)
Copyright 1988-2018, All rights reserved.
References in periodicals archive ?
Amplification with the outer primers RS-3 (5' TGAAGTTAGTGCCCAGATGCAGG 3') and RS-4 (5' GCTCAGCGCCCAGTATA TGACC 3') yielded a 367-bp product.