TGAG

AcronymDefinition
TGAGTexas Gospel Announcers Guild (Houston, TX)
References in periodicals archive ?
Loci Motif Forward Reverse dec-1 TG CGCGGCCATACATTTAATCA CGGCAATAAATCAAACCAGAA dec-2 TGAG ATGCATCCCTCACCTTTGAA TCAGGCAAATCTTAAACATAATCG dec-3 AG TTGAACCCTGGACCTTAGGA TTTATAGTGTCGATTCGCCGTA dec-4 TC CAGCGCATCTGATTCTGGTA CATTCAGTGACGGTCTAATGG dec-5 TCA TGGGATTGCATTTGTTATTCG GTTCGATTGTGACGCCATTA dec-6 AAC CGTTGGAGGAAGTGAATGTC GCTACCACTAGCAAGGCACA dec-7 CAT AAAAGCGAGTGGGCCTTATT CAATCGCAATGGACAATCAC Loci tm Percent GC PCR product size dec-1 61-59 45-38 250 pb dec-2 60-59 45-33 216 pb dec-3 59 50-40 100 pb dec-4 59-58 50-47 264 pb dec-5 60-59 38-15 200 pb dec-6 59 50-55 240 pb dec-7 59 45-45 246 pb TABLE 3.
TGAG consults to a range of clients throughout Asia in industries as diverse as retail, manufacturing, hospitality and primary resources.