TGTC

AcronymDefinition
TGTCThe Greater Than Club (band)
TGTCTexas Geometry and Topology Conference (mathematics)
TGTCThames Gateway Technology Centre (London, UK)
TGTCTobago Gas Technology Conference (University of Trinidad and Tobago )
TGTCTexas Gas Transmission Corporation
TGTCTexas Gymnastics Training Center (Mesquite, TX)
TGTCTachy Goes to Coventry (vBulletin forum software feature)
TGTCTrinity Gardens Tennis Club (Australia)
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Primer information for real-time qRT-PCR Name Gene ID Primer (5' to 3') PPAR[gamma] NM_181024 Sense: GATAGGTGTGATCTTAAC TGTC GGAT Anti-sense: CGCTAACAGCTTCTCCTTCTCG FASN NM_001012669 Sense: CTGGAGCGTGAGCACAACCTG Anti-sense: GTGTGGAGTCCGTCAGCTCAT ACADM BC102989 Sense: TGTGCCTATTGTGTAACAGAACCT Anti-sense: TCCATTGGTGATCCACATCTTCTGAC GAPDH NM_001034034 Sense: CGTGTCTGTTGTGGATCTGACCTG Anti-sense: CAACCTGGTCCTCAGTGTAGCCT
Protein Restriction Primer sequences (5 -3 ) sites SLA-His-coli BsmBI F: ATTACGTCTCACATGAACCGCGAGAGCTTCGCGGCG BsmBI R: ATTACGTCTCTTCGAGTGAAGAAGCATCCTGGTATG TGTC SLA-HEK BsmBI F: ATTACGTCTCACATGAACCGCGAGAGCTTCGCGGCG BsmBI R: ATTACGTCTCTTCGAGTCATGAAGAAGCAT CCTGGTATGTG
Primer sequences were as follows: AhR, forward 5-GACC AAACACAAGCTAGACTTCACACC, reverse 5-CAAGAAGCCGGAAAACTGTC ATGC; Cyp1A1, forward 5-AGTCAATC TGAGCAAT GAGTTTGG-3', reverse 5'-GGCATCCAGGGAAGAGTTAGG-3'; GAIDH, forward 5'-GCCAAAAGGGTC ATCATCTC-3', reverse 5-GGCCATCC ACAGTCTTCT-3; Tnf-alpha, forward 5'-CCCACTCTGACCCCTTTACTC-3', reverse 5 -TCAC TGTC CCAG CATC TTGT-3; F4/80, forward 5'-CTTTGGCT ATGGGCTTCCAGTC-3', reverse 5-GCAA GGAGGACAGAGTTTATCGTG-3'.
PCR was carried out using these primers for circ121 (F: AAG CTC GGT CAC TTT GGA and R: CTT TGG GCT CAG GAA TCA), circ217 (F: CCA TCA ATG GAG TGA CTG AG and R: CAC AAG GGA GCC AAG ATT AT), circ252 (F: CAT TGT CAT GCA AGC TGTC and R: CTC TTT GTG CTT CCA GGTA), circ276 (F: TGG CTC CAG TAA CTC CATC and R: ATC ATC TCC ACC CCG AAA GT), circ443 (F: GTG GTC AAT AAT GCT GAT GA and R: TTC CCA GTT CCA GTC TGTC), circ465 (F: CTG GAA AAT TGC TCT TCTC and R: CCT TCT AGC TTT AGA CCT TT), circ543 (F: GAC GGA ACT TCA TCA ACAA and R: TTC CCA GTC ATC TTC AGC), circ742 (F: AGC AGG AGA TGG AGG AGG AC and R: GGT GAC CTG CCT TCT GGA CT), and circ783 (F: TAT CTG CCC TCC CAG TCC C and R: TGT GGC TGA GAA TGA GGG TTAC).