TIP47

AcronymDefinition
TIP47Tail-Interacting Protein of 47
References in periodicals archive ?
Bickel, "S3-12, adipophilin, and TIP47 package lipid in adipocytes," The Journal of Biological Chemistry, vol.
Brasaemle, "TIP47 associates with lipid droplets," The Journal of Biological Chemistry, vol.
Pfeffer, "TIP47 is not a component of lipid droplets," The Journal of Biological Chemistry, vol.
Hofnagel, "TIP47, a lipid cargo protein involved in macrophage triglyceride metabolism," Arteriosclerosis, Thrombosis, and Vascular Biology, vol.
Himmelsbach et al., "TIP47 is associated with the Hepatitis C virus and its interaction with Rab9 is required for release of viral particles," European Journal of Cell Biology, vol.
Increase in the mRNA expression of genes specific to LD proteins like perilipin, adipophilin, TIP47, and FSP27 by 3.5-, 7.8-, 4.1- and 6.4-folds, respectively, was observed during HFFD feeding compared to CON.
A recent study has shown that reducing ADRP and TIP47 in the liver via antisense oligonucleotide treatment attenuated steatosis and improved insulin sensitivity and glucose metabolism in C57BL/6J mice fed with high-fat diet [24].
Genes Forward [right arrow] Reverse [right arrow] 3'-5' 3'-5' SREBP-1c gcctatttgatgccccctat cccagagaagcaggagaaga HMG CoA tgcttggtttctggctcttt ttaacccattggaggtgagc reductase PPAR-[alpha] cgttttggaagaatgccaag gccagagatttgaggtctgc Perilipin gagcgaattccaagacatcg tgtctcggttttgtcatcca Adipophilin tccgcaatgttacctccttc aagggacctaccagccagtt TIP47 atgtgttcccccaaactgag tgtaggcagcactcaccatc FSP27 actgcagtggtgacccaac atgatgcctttgcgaacct GAPDH aaggggaacccttgatatgg cggagatgatgacccttttg
LSDP5 is a newly identified member of the perilipin, ADFP, and TIP47 (PAT) family, which is ubiquitously expressed in tissues that exhibit high levels of fatty acid oxidation, including the heart, muscle, and liver [12, 40, 41].