TLR7


Also found in: Wikipedia.
AcronymDefinition
TLR7Toll Like Receptor 7
References in periodicals archive ?
TLR7 sets in motion a cascade of events that rev up production of a second protein, interleukin-23, which guides immune cells on seek-and-destroy missions against cells infected with the virus.
ANA975, an organ prodrug of Anadys' small molecule compound isatoribine, belongs to a new class of drugs being developed to regulate innate immunity by interacting with TLR7. Novartis says ANA975 is currently in Phase I development for the treatment of HCV.
Self-RNA-antimicrobial peptide complexes activate human dendritic cells through TLR7 and TLR8.
Among various NA sensors, the endosomal RNA sensor TLR7 plays a central role in the development of SLE, at least in various animal models.
Surprisingly, we found that TLR7 mRNA expression was significantly lower in MAVS KO mice as compared with WT mice.
The following monoclonal antibodies were used for these studies: PE-conjugated rat IgG1 (R3-34), APC-conjugated rat IgG1 (R3-34), APC-cy7-conjugated anti-mouse CD3 (145-2C11), Alexa Fluor 647-conjugated anti-mouse TLR2 (6C2), PE-conjugated anti-mouse TLR4 (MTS510), PE-conjugated anti-mouse TLR7 (A94B10), PerCP-Cy5.5-conjugated anti-mouse CD4 (RM4-5), APC-conjugated anti-mouse CD8 (RPAT8), FITC-conjugated anti-mouse [gamma][delta] TCR (GL3), APC-cy7-conjugated anti-mouse CD11b (M1/70), PE-conjugated anti-mouse Ly6G (1A8), FITC-conjugated anti-mouse CD94 (20d5), PE-conjugated anti-mouse CD314 (XMG1.2), APC-conjugated anti-mouse IFN-[gamma] (XMG1.2), PE-conjugated anti-mouse IL-4 (11B11), PE-conjugated anti-mouse IL-17A (TC11-18H10), and APC-conjugated anti-mouse IL-5 (TRFK5).
These TLRligands canbe grouped into three categories: lipids and lipopeptides (recognised by TLR2/TLR1, TLR2/TLR6, and TLR4), proteins (recognised by TLR5), and nucleic acids (recognised by TLR3, TLR7, TLR8, and TLR9).
Exposure to inflammatory cytokines has been reported to alter the TLR profile of MSCs [96, 98], causing an upregulation of TLR2-3 [95, 96, 98], TLR4 [95, 98], and TLR7 [96] and a downregulation of TLR6 [98] which causes a change in the responsiveness of the cells to TLR stimulation [98].
Primer Sequence Glyceraldehyde 3-phosphate TTCCAGGAGCGAGATCCCT dehydrogenase (GAPDH) Caspase-1 ABI Hs00354836_m1 Interleukin-6 (IL-6) Hs02621719_u1 Monocyte chemoattractant GCAATCAATGCCCCAGTCA protein-1 (MCP-1) Toll-like receptor 1 (TLR1) AACCCATTCCGCAGTACTCCA Toll-like receptor 2 (TLR2) CAATGATGCTGCCATTCTCAT Toll-like receptor 3 (TLR3) ACAACTTAGCACGGCTCTGGA Toll-like receptor 4 (TLR4) AGTTTCCTGCAATGGATCAAGG Toll-like receptor 5 (TLR5) GGCTTAATCACACCAATGTCACTAT Toll-like receptor 6 (TLR6) CCCATTCCACAGAACAGCAT Toll-like receptor 7 (TLR7) TGGAAATTGCCCTCGTTGTT Toll-like receptor 8 (TLR8) CTTCGATACCTAAACCTCTCTAGCAC Toll-like receptor 9 (TLR9) CTAGCTCTTAATCCTGATG Table 2: Baseline characteristics of the collected deciduous dental pulps (A = 161).
Two defects of apoptosis are associated with SLE: (i) the failure of immune system cells to enter apoptosis program, due to defects in Fas pathway, which leads to production of auto-reactive lymphocytes, triggering initiation of pathogenic mechanism of SLE; (ii) the impairment of the removal for apoptotic debris causes inflammation, which implies activation of TLR7 and TLR9 pathway, leading to initiation of pathogenic mechanism of SLE [33].
One group is composed of TLR1, TLR2, TLR4, TLR5, TLR6, and TLR10, which are expressed on cell surfaces and recognize microbial membrane components such as lipids, lipoproteins, and proteins; the other group is composed of TLR3, TLR7, TLR8, and TLR9, which are expressed exclusively in intracellular vesicles, and they recognize microbial nucleic acids (Cario, 2005).
For instance, it has been shown that lipopolysaccharides (LPS), a TLR4 agonist, and ssRNA (TLR7 and TLR8 ligands) accelerate pancreatic carcinogenesis [11, 12].