TRNA


Also found in: Dictionary, Thesaurus, Medical, Encyclopedia, Wikipedia.
Related to TRNA: rRNA, suppressor tRNA
AcronymDefinition
TRNATransfer Ribonucleic Acid
TRNATemporarily Restricted Net Asset
TRNATUV (Technischer Überwachungsverein) Rheinland of North America, Inc. (German company subsidiary)
References in periodicals archive ?
The two sweetlips mitochondrial genomes contain 22 tRNA genes, which are interspersed between rRNA and protein-coding genes, ranging from 67 (tRNACys, tRNASer(AGY)) to 76 (tRNALys(UUR)) nucleotides in length (Table III).
Using blood samples from people with epilepsy, the researchers found that fragment levels of three tRNAs "spike" in the blood many hours before a seizure.
Table 1 Primers, references, and parameters used in polymerase chain reaction (PCR) and Sanger sequencing Amplicon Primer Sequence 5' to 3' PAT-2 CTTTGAAGGCTTTTAGTTTAGATTAAC ECOIB GGTAGTCTGAGTATCGTCG(A/T)G tRNAs + COI COIceF ACTGCCCACGCCCTAGTAATGATATTTTTTATGGTNATGCC COIceR TCGTGTGTCTACGTCCATTCCTACTGTRAACATRTG 12Sa ACACATCGCCCGTCACTCTC 16Sb GACGAGAAGACCCTATCGAGC 12S.
fucata martensii encoded 12 PCG, three rRNA genes, and 21 tRNA genes on the heavy strand (Fig.
Thus there are 20 distinct types of tRNA molecules, each capable of linking to one particular amino acid.
Rando suspects tRNA fragments play a central role in both findings, and he is starting experiments now to test that hypothesis.
Existing studies of [m.sup.5]C in cellular RNA have been largely confined to rRNA and tRNA [17].
Muscular mtDNA sequencing showed the heteroplasmic mutations m.5835G>A in MT-TY gene, coding for tRNA Tyrosine.
Of these, the GARS gene located on chromosome 7p produces an aminoacyl tRNA synthetase responsible for charging the associated tRNAs and the first protein of its kind implicated in any inherited human disorder.
Positional isomers of cyclic nucleotides 3',5'-cGMP and 2',3'-cGMP, tRNA from Torula yeast, and 3',5'-cGMP were purchased from Sigma-Aldrich (Germany).