UREC

AcronymDefinition
URECUnité Réseaux du CNRS (French)
URECUniversity Research Ethics Committee (various universities)
URECUnavoidable Residual Environmental Contamination (organic agriculture)
URECUrban Restoration Enhancement Corporation (Baton Rouge, LA)
URECUnion Real Estate Company (Safat, Kuwait)
URECUnited Refining Energy Corp.
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
If the projected numbers from UREC (as suggested in the press release) are correct, then according to the Chairman of Gintech, Pan Wen-yan, (quoted by Renewables Now) the new flagship solar company may be producing 25 percent of Taiwan's solar generated electricity, and 5 percent of the country's total energy by 2025.
The amplification was carried out in a thermal cycler as previously mentioned in ureC (glmM) gene but the annealing temperature was 55[degrees]C for cagA, 56[degrees]C for iceA1, and 50[degrees]C for iceA2.
Gene Primer Nucleotide sequence ureC (glmM) Hp-F GGATAAGCTTTTAGGGGTGTTAGGGG HP-R GCTTACTTTCTAACACTAACGCGC cag E cag E-F TTGAAAACTTCAAGGATAGGATAGAGC cagE-R GCCTAGCGTAATATCACCATTACCC bab A2 bab A2-F CCAAACGAAACAAAAAGCGT bab A2-R GCTTGTGTAAAAGCCGTCGT babB babB -F ATGAAAAAAACCCTTTTAC babB-R CGAATTGCAAGTGATGGT cagA cagA-F AGGGATAACAGGCAAGCTTTTGA cagA-R CTGCAAAAGATTGTTTGGCAGA iceAl iceAl-F GTGTTTTTAACCAAAGTATC iceAl-R CTATAGCCASTYTCTTTGCA iceA2 iceA2-F GTTGGGTATATCACAATTTAT iceA2-R TTRCCCTATTTTCTAGTAGGT Gene Size (bp) Reference ureC (glmM) 294 [13] cag E 508 [12] bab A2 971 [6] babB 496 [14] cagA 352 [15] iceAl 247 [13] iceA2 229 [13] TABLE 2: Relationship between clinical outcome and status of cagE, babA2, babB, iceAl, iceA2, and CagA.
The iceA gene has two allelic types, iceA1 and iceA2 where iceA1 is significantly expressed and associated with peptic ulceration.10 The ureC encodes for phosphoglucosamine mutase, and renamed as glmM gene.
This study used ureA gene and ureC (glmM) genes as the PCR target.
pylori was based on the amplification of the ureA [34], ureA plus ureB [35], and ureC genes [36, 38].
UreC PCR based diagnosis of Helicobacter pylori infection and detection of cagA gene in gastric biopsies.
Rapidement, la propagande troqua ce terme pour celui de Uniones Revolucionarias de Campesinos (Unions Revolutionnaires de Paysans / UREC), formule raffinee d'organisation propre au monde agraire, aux dires de Patria Roja (92).
In two dimensions, the concept of unambiguity is straightforward and yields to class UREC [14].