UTR


Also found in: Medical, Wikipedia.
AcronymDefinition
UTRUntranslated Region (genetics)
UTRUnder the Radar
UTRUnicode Technical Report
UTRUnique Taxpayer Reference (UK Inland Revenue)
UTRUnable to Reach
UTRUnion des Théatres Romands (French; Swiss theater association)
UTRUnable to Reproduce
UTRUniversity Technical Representative
UTRUniform Temperature Reference
UTRUptime Ratio
UTRUnderwater Tracking Range
UTRUniversity Training Reactor
UTRUnit Under Test Requirements Interface
UTRUnité Thématique de Recherche (French)
UTRUniversal Transaction Record
UTRUnit Task Reorganization
UTRUkrainian T-Shape Radio Telescope
UTRUnderwriter To Review
UTRUp through Roof (mechanics)
UTRUrinary Tract Relief (veterinary medicine)
UTRUpset the Rhythm (UK)
References in periodicals archive ?
To confirm this account of the communications held between the Company and Party A, and to allow for shareholders to determine on their own whether or not the Board effectively discharged its duties to maximize shareholder value, we demand that all significant activity between UTR and the Company be released.
UTR is a nonprofit organization that unites families facing physical separation by having parents read aloud to their children via DVD.
Processing of the prothrombin pre-mRNA is also stimulated by an upstream sequence element located in the 3' UTR of the mRNA.
Sequence, 5' [right arrow] 3' ([dagger]) location AiV-F65 CACCGTTACTCCATTCAGCTTCTTC 65-89 5' UTR AiV-F69 GTTACTCCATTCAGCTTCTTCGGAAC 69-94 5' UTR AiV-R1039 CAGGATTGGACATCAGAATCATAGAG 1039-1064 Leader AiV-R1049 GGATAGAACCAGGATTGGACATCAG 1049-1073 Leader AiV-F274 CCAGCCTGACGTATCACAGG 274-293 5' UTR AiV-R313 AAGCTGCTCACGTGGCAATTGTG 313-335 5' UTR AiV-P294 FAM-CTGTGTGAAGYCC-MGBNFQ 294-306 5' UTR AiV-F2984 CAGGCATTCATCTCYGCAGGTGAA 2984-3007 VP1 AiV-F2995 CTCYGCAGGTGAATCCTTCAACGT 2995-3018 VP1 AiV-R3881 TTGCGGATGGCCCAGTGGACGTA 3884-3906 VP1 AiV-R3884 GATGGCCCAGTGGACGTAGGT 3881-3901 VP1 ID no.
However, PCR targeted at the 5" untranslated region (UTR) of enterovirus (13) was negative, whereas a 5' UTR PCR specific for HPeV (12) was positive.
AB084913), the nucleotide identity of the 3 Canadian strains for part of the 5' UTR region was 88.
Lot 2 - UTR of Boulay - circuits BOU 1 N2E - BOU N3E 1 125,000.
Major organization : REGIONE AUTONOMA DELLA SARDEGNA ASSESSORATO DEI LAVORI PUBBLICI, SERVIZIO APPALTI, CONTRATTI E SEGRETERIA UTR
a leading provider of products for studying the regulatory elements in the human genome, today announced the application of its UTR Reporter Collection[TM] product line in uncovering critical miRNA functions in several recent research studies.