UNG

(redirected from Uracil-N-Glycosylase)
AcronymDefinition
UNGUniversity of North Georgia (est. 2013)
UNGUnited States Natural Gas Fund LP (stock symbol)
UNGUnguent (ointment, medical)
UNGUracil-N-Glycosylase
UNGUniversity of Geneva (Geneva, Switzerland)
UNGUNG's not GNU
UNGUnified Newspaper Group (Madison, WI)
References in periodicals archive ?
An effective hot start is provided here by the use of dUTP and uracil-N-glycosylase in the PCR.
Known as base excision repair, it begins with the uracil-N-glycosylase enzyme, which acts to search through dsDNA for any uracil residues.
We considerably decreased the risk of horizontal and vertical contamination of the PCR reaction by using uracil and uracil-N-glycosylase and by keeping reaction cups closed since the first amplification cycle.
PCR was performed in a 10-[micro]L final volume and contained 5 [micro]L of TagMan 2X Universal PCR Master Mix [AmpliTaq Gold polymerase, Amperase uracil-N-glycosylase, dUTP, dGTP, dCTP, dATP, 6-carboxy-x-rhodamine (ROX) dye, Tris-HCI, KCI, Mg[Cl.sub.2]], 200 nmol/L mutant allele probe (5'FAM-CAAAGAATCAAGCACTTTTCGAAACATTG-TAMRA3'), 150 nmol/L VIC wild-type allele probe (5' VIC-CAAAGAATCAA000CTTTTCGAAACA-TAMRA3'), 900 nmol/L forward primer (5'GCAGCTCATGACAATTTGAAGCT3'), 900 nmol/L reverse primer (5'GGTGACACCAAGTTCaaaaaCAAC3'), and 2 20 ng of genomic DNA.