VEGFA

AcronymDefinition
VEGFAVascular Endothelial Growth Factor
References in periodicals archive ?
Interestingly, the analysis in vivo of circulating plasma VEGFA concentrations showed significant associations of VEGFA with the concentrations of miRNAs involved in VEGFA regulation (Table 2).
6] Nonstandard abbreviations: miRNA, microRNA; BMI, body mass index; LIFR, leukemia inhibitory factor receptor; VEGFA, vascular endothelial growth factor A; RT, reverse transcription; Ct, thermal cycle; TGFBR1, transforming growth factor-[beta] receptor; JAK-STAT, Janus kinase signal transducer and activator of transcription; MAPK, mitogen-activated protein kinase.
Salt-free primers for target genes VEGFA, VEGFB, VEGFC, VEGFD and PGF, as well as for housekeeping gene GAPDH, were generated by Invitrogen[TM].
Table 1 Primers for Human VEGFA, B, C, D, PGF and GAPDH PCR Product Gene Sequence Size VEGFA Forward: GGGCAGAATCATCACGAAGT (100-119) 211 Reverse: TGGTGATGTTGGACTCCTCA (221-310) VEGFB Forward: CCCTTGACTGTGGAGCTCAT (163-172) 203 Reverse: CACTGGCTGTGTTCTTCCAG (346-365) VEGFC Forward: CACTTGCTGGGCTTCTTCTC (4-23) 173 Reverse: TGCTCCTCCAGATCTTTGCT (157-176) VEGFD Forward: TGTAAGTGCTTGCCAACAGC (565-574) 163 Reverse: GTGGATTTTCCTCCTGCAAA (708-727) PGF Forward: GTTCAGCCCATCCTGTGTCT (216-235) 163 Reverse: AACGTGCTGAGAGAACGTCA (359-378) GAPDH Forward: TGAAGGTCGGAGTCAACGGAT (11-31) 181 Reverse: TTCTCAGCCTTGACGGTGCCA (171-191) PCR, polymerase chain reaction; VEGF, vascular endothelial growth factor; PGF, placental growth factor; GAPDH, glycerol-3-phosphate dehydrogenase.
69 Superfamily, Member 13B VEGFA Vascular Endothelial Growth Factor -4.
qPCR of VEGFA mRNA was performed on samples of MCF-7 cells treated with either vehicle (i.
The finding of an increased expression level in tumors relative to adjacent normal tissues for the majority of targets is in line with their potential function as mitogens (ESR1, PGR, and ERBB2) or dysregulated oncogenes (BIRC5, VEGFA, and TOP2A) in breast cancer.
Twelve genes were selected from among genotyped MESA candidate genes: ACE, ADRB2, AGT, AGTR1, ALOX15, EDN1, GRK4, PTGS1, PTGS2, TLR4, VEGFA, and VEGFB.
MicroRNA-26a inhibits angiogenesis by down-regulating VEGFA through the PIK3C2[alpha]lpha/Akt/HIF-l alpha pathway in hepatocellular carcinoma.
A total of 12 TGF-3 pathway downstream genes were found to be differentially expressed (Table 3), which are related to regulation of cell cycle progression (CDC6, CDKN1B, GADD45B, NFKBIA), cytokine and growth factors (1110, TNFSF10, PDGFA, angiogenesis (NOTCH1, VEGFA, PDGFA) and ECM deposition (FN1).
CACNA1D, EDNRA, KCNG2, NR3C2, PDE4D, ACE, ADRA1B, ADRB3, KCNJ11, ADRAJD Cardiac dilation Imipramine EPO, NOS1 Pulmonary hypertension EtOH-Fr EDNRB, FTGER3, PDE5A Pulmonary hypertension Imipramine EPO, EDNRB, FLT3, ABL1, EDNRA, ADRA1B, ADRB3, ADRA1D Increased levels of alkaline EtOH-Fr VEGFA phosphatase Bold indicate that these genes are prevalent in several disease clusters.
VEGFA (commonly referred to as VEGF) is a potent angiogenic factor that mediates most biological functions via KDR (VEGFR2), and expressed as various isoforms due to alternative splicing which leads to mature 121 -, 165-, 189- and 206-amino-acid proteins.