VEGFB

AcronymDefinition
VEGFBVascular Endothelial Growth Factor B
References in periodicals archive ?
Salt-free primers for target genes VEGFA, VEGFB, VEGFC, VEGFD and PGF, as well as for housekeeping gene GAPDH, were generated by Invitrogen[TM].
Table 1 Primers for Human VEGFA, B, C, D, PGF and GAPDH PCR Product Gene Sequence Size VEGFA Forward: GGGCAGAATCATCACGAAGT (100-119) 211 Reverse: TGGTGATGTTGGACTCCTCA (221-310) VEGFB Forward: CCCTTGACTGTGGAGCTCAT (163-172) 203 Reverse: CACTGGCTGTGTTCTTCCAG (346-365) VEGFC Forward: CACTTGCTGGGCTTCTTCTC (4-23) 173 Reverse: TGCTCCTCCAGATCTTTGCT (157-176) VEGFD Forward: TGTAAGTGCTTGCCAACAGC (565-574) 163 Reverse: GTGGATTTTCCTCCTGCAAA (708-727) PGF Forward: GTTCAGCCCATCCTGTGTCT (216-235) 163 Reverse: AACGTGCTGAGAGAACGTCA (359-378) GAPDH Forward: TGAAGGTCGGAGTCAACGGAT (11-31) 181 Reverse: TTCTCAGCCTTGACGGTGCCA (171-191) PCR, polymerase chain reaction; VEGF, vascular endothelial growth factor; PGF, placental growth factor; GAPDH, glycerol-3-phosphate dehydrogenase.
Twelve genes were selected from among genotyped MESA candidate genes: ACE, ADRB2, AGT, AGTR1, ALOX15, EDN1, GRK4, PTGS1, PTGS2, TLR4, VEGFA, and VEGFB.