VEGFB

AcronymDefinition
VEGFBVascular Endothelial Growth Factor B
References in periodicals archive ?
The DNA clones for EGFR, KI67, VEGFA and VEGFB showed the highest expression in cluster 1, while.
The determination of tumor markers in artemsinin-sensitive PC-3 and artemisinin-resistant DU-145 prostate carcinoma cells showed that high TFR, 10X1, MYC, and VEGFC expression was found in sensitive PC-3 cells and high ECFR, KI67, VEGFA, and VEGFB expression in resistant DU-145 cells.
Here, we observed that artemisinin-resistant DU-145 prostate cancer cells expressed more VEGFA and VEGFB but less VEGFC than sensitive PC-3 cells.
Salt-free primers for target genes VEGFA, VEGFB, VEGFC, VEGFD and PGF, as well as for housekeeping gene GAPDH, were generated by Invitrogen[TM].
Table 1 Primers for Human VEGFA, B, C, D, PGF and GAPDH PCR Product Gene Sequence Size VEGFA Forward: GGGCAGAATCATCACGAAGT (100-119) 211 Reverse: TGGTGATGTTGGACTCCTCA (221-310) VEGFB Forward: CCCTTGACTGTGGAGCTCAT (163-172) 203 Reverse: CACTGGCTGTGTTCTTCCAG (346-365) VEGFC Forward: CACTTGCTGGGCTTCTTCTC (4-23) 173 Reverse: TGCTCCTCCAGATCTTTGCT (157-176) VEGFD Forward: TGTAAGTGCTTGCCAACAGC (565-574) 163 Reverse: GTGGATTTTCCTCCTGCAAA (708-727) PGF Forward: GTTCAGCCCATCCTGTGTCT (216-235) 163 Reverse: AACGTGCTGAGAGAACGTCA (359-378) GAPDH Forward: TGAAGGTCGGAGTCAACGGAT (11-31) 181 Reverse: TTCTCAGCCTTGACGGTGCCA (171-191) PCR, polymerase chain reaction; VEGF, vascular endothelial growth factor; PGF, placental growth factor; GAPDH, glycerol-3-phosphate dehydrogenase.