VEGFC

AcronymDefinition
VEGFCVascular Endothelial Growth Factor C (protein)
References in periodicals archive ?
The determination of tumor markers in artemsinin-sensitive PC-3 and artemisinin-resistant DU-145 prostate carcinoma cells showed that high TFR, 10X1, MYC, and VEGFC expression was found in sensitive PC-3 cells and high ECFR, KI67, VEGFA, and VEGFB expression in resistant DU-145 cells.
VEGFA and VEGFC are known as prognostic markers in prostate cancer associated with clinical recurrence and metastasis (Jennbacken et al.
The high expression of MYC, TFR, and VEGFC in the patient biopsy corresponded with high expression of these markers in the artemisinin-sensitive PC-3 cells compared to artemisinin-resistant DU-145 cells.
Salt-free primers for target genes VEGFA, VEGFB, VEGFC, VEGFD and PGF, as well as for housekeeping gene GAPDH, were generated by Invitrogen[TM].
This suggests that angiogenesis involving MSCs does not require VEGFC.
Table 1 Primers for Human VEGFA, B, C, D, PGF and GAPDH PCR Product Gene Sequence Size VEGFA Forward: GGGCAGAATCATCACGAAGT (100-119) 211 Reverse: TGGTGATGTTGGACTCCTCA (221-310) VEGFB Forward: CCCTTGACTGTGGAGCTCAT (163-172) 203 Reverse: CACTGGCTGTGTTCTTCCAG (346-365) VEGFC Forward: CACTTGCTGGGCTTCTTCTC (4-23) 173 Reverse: TGCTCCTCCAGATCTTTGCT (157-176) VEGFD Forward: TGTAAGTGCTTGCCAACAGC (565-574) 163 Reverse: GTGGATTTTCCTCCTGCAAA (708-727) PGF Forward: GTTCAGCCCATCCTGTGTCT (216-235) 163 Reverse: AACGTGCTGAGAGAACGTCA (359-378) GAPDH Forward: TGAAGGTCGGAGTCAACGGAT (11-31) 181 Reverse: TTCTCAGCCTTGACGGTGCCA (171-191) PCR, polymerase chain reaction; VEGF, vascular endothelial growth factor; PGF, placental growth factor; GAPDH, glycerol-3-phosphate dehydrogenase.