VICR

AcronymDefinition
VICRVirgin Islands Coral Reef National Monument (US National Park Service)
VICRVelocity Induced Catalytic Reactor (Ionizer)
References in periodicals archive ?
Gene Primer seq 5'-3' gtfB F-AGCAATGCAGCCAATCTACAAAT R-ACGAACTTTGCCGTTATGTCA gtfC F-GGTTTAACGTCAAAATTAGCTGTATTAGC R-CTCAACCAACCGCCACTGTT ftf F-AAATATGAAGGCGGCTACAACG R-CTTCACCAGTCTTAGCATCCTGAA gbpB F-ATGGCGGTrATGGACACGTT R-TTTGGCCACCTTGAACACCT VicR F-TGACACCAUACAGCCITFGATG R-CGTCTAGTTCTCGTAACATTAACTCCAATA brpA F-GGAGGAGCTGCATCAGGATTC R-AACTCCAGCACATCCAGCAAG RelA F-ACAAAAAGGGTATCGTCCGTACAT R-AATCACGCTTGGTAUGCTAATTG spaP F-GAGGTAATGGTFATGCATCAA R-TITGTATCAGCCGGATCAAGTG 16S rRNA F-CCTACGGGAGGCAGCAGTAG R-CAACAGAGCTTTACGATCCGAAA Smu0630 F-GTTAGTTCTGGTTTTGACCGCAAT R-CCCTCAACAACAACATCAAAGGT F-forward; R-reverse.
Tickers featured: APTI, ATSN, BELFA, CHP, EMR, IRF, MAG, PHG, POWI, PWER, SMTC, SYXI, TXN, TYC, VICR.
Vicor Corporation (NASDAQ: VICR, "Vicor") today announced that it has entered into a non-exclusive license with Sony Corporation ("Sony") relating to Vicor's Factorized Power Architecture, V-I Chip power converters and the enabling technologies and semiconductor components used in V-I Chips.