VICR

AcronymDefinition
VICRVirgin Islands Coral Reef National Monument (US National Park Service)
VICRVelocity Induced Catalytic Reactor (Ionizer)
References in periodicals archive ?
Gene Primer seq 5'-3' gtfB F-AGCAATGCAGCCAATCTACAAAT R-ACGAACTTTGCCGTTATGTCA gtfC F-GGTTTAACGTCAAAATTAGCTGTATTAGC R-CTCAACCAACCGCCACTGTT ftf F-AAATATGAAGGCGGCTACAACG R-CTTCACCAGTCTTAGCATCCTGAA gbpB F-ATGGCGGTrATGGACACGTT R-TTTGGCCACCTTGAACACCT VicR F-TGACACCAUACAGCCITFGATG R-CGTCTAGTTCTCGTAACATTAACTCCAATA brpA F-GGAGGAGCTGCATCAGGATTC R-AACTCCAGCACATCCAGCAAG RelA F-ACAAAAAGGGTATCGTCCGTACAT R-AATCACGCTTGGTAUGCTAATTG spaP F-GAGGTAATGGTFATGCATCAA R-TITGTATCAGCCGGATCAAGTG 16S rRNA F-CCTACGGGAGGCAGCAGTAG R-CAACAGAGCTTTACGATCCGAAA Smu0630 F-GTTAGTTCTGGTTTTGACCGCAAT R-CCCTCAACAACAACATCAAAGGT F-forward; R-reverse.
Tickers featured: APTI, ATSN, BELFA, CHP, EMR, IRF, MAG, PHG, POWI, PWER, SMTC, SYXI, TXN, TYC, VICR. Complete text approximately 3000 words.
* Vicor (NASDAQ: VICR) stock set a new 52-week low of $27.81 on Monday, moving down 4.63%.
I was able work on a fantastic stencil study this summer with Vicor's (vicr.com) Ray Whittier to find out.
* Vicor Corp (NASDAQ: VICR) fell 8.7% to close at $30.53 after the company reported worse-than-expected Q2 EPS and sales results.
Also higher were Vicor Corporation (VICR) and iRobot (IRBT), which gained a respective 22% and 24% after reporting quarterly results.
When Ray Whittier of Vicor (vicr.com) wanted to choose a vendor, he listed the factors deemed important to his assembly operation, surveyed the supply base, and arrived at a short list of four potential suppliers.
Ray Whittier of Vicor (vicr.com) demonstrates how he uses his white light SPI system to verify new stencils before putting them into production: The official ISO 9001 documented procedure involves printing two dummy boards and inspecting them with the SPI machine.
* Vicor Corp (NASDAQ: VICR) fell 7.5% to $30.93 in pre-market trading after the company reported worse-than-expected Q2 EPS and sales results.